Construct: ORF TRCN0000480604
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006967.1_s317c1
- Derived from:
- ccsbBroadEn_15789
- DNA Barcode:
- GCGACTTGCCAATGGAACAGTTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SH3YL1 (26751)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480604
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NM_001159597.2 | 99.8% | 100% | 279A>G |
| 2 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NM_015677.4 | 94.3% | 94.4% | 279A>G;782_838del |
| 3 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NM_001282682.1 | 70.2% | 69.9% | 0_1ins285;2_3insTGA |
| 4 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NM_001282687.1 | 66.3% | 66% | 0_1ins285;2_3insTGA;494_550del |
| 5 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NR_104225.1 | 47.7% | (many diffs) | |
| 6 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NR_104226.1 | 38.7% | (many diffs) | |
| 7 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NR_104227.1 | 29.1% | (many diffs) | |
| 8 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NR_104223.1 | 28.4% | (many diffs) | |
| 9 | mouse | 24057 | Sh3yl1 | Sh3 domain YSC-like 1 | NM_013709.5 | 81.5% | 87.7% | (many diffs) |
| 10 | mouse | 24057 | Sh3yl1 | Sh3 domain YSC-like 1 | NM_001289480.1 | 72.1% | 76.9% | (many diffs) |
| 11 | mouse | 24057 | Sh3yl1 | Sh3 domain YSC-like 1 | NR_110343.1 | 44.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1035
- ORF length:
- 969
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa taaccctata ccttccaatt tgaaatcaga agcaaaaaag gctgccaaaa 121 tattaagaga attcacagaa ataacttcca gaaatggacc tgataagatc attcctgctc 181 acgtaattgc gaaggctaaa ggccttgcaa ttctgtctgt gatcaaagcc gggttcctgg 241 tgactgccag aggaggcagc gggattgtag tggcgcgcct tccagatgga aaatggtctg 301 caccctcagc cattgggata gctggccttg gtggaggatt tgagatagga attgaggtat 361 cagacttggt gataattctg aattatgacc gtgctgtaga agcttttgca aaaggcggaa 421 atctgaccct cggagggaac ttgactgtgg cggttgggcc cttgggaagg aacttggaag 481 gaaacgtggc cctgagaagc tccgctgccg tcttcacgta ctgcaagtca agGGGACTCT 541 TTGCAGGCGT GTCTTTAGAA GGGAGCTGTT TGATTGAAAG GAAAGAAACT AATAGAAAAT 601 TTTATTGTCA AGATATCCGA GCTTATGACA TTTTATTTGG AGATACACCG CGGCCTGCTC 661 AAGCCGAAGA TCTTTATGAA ATTCTTGATT CCTTTACTGA AAAGTATGAA AATGAAGGAC 721 AACGAATCAA TGCAAGAAAA GCAGCAAGGG AGCAGAGGAA GTCTTCTGCT AAAGAATTAC 781 CTCCAAAGCC ATTGTCAAGA CCACAGCAGT CATCTGCACC AGTCCAGCTG AACTCTGGCT 841 CTCAAAGCAA TTTGAATCAA CCCATAGAAG TGACAGCGCT GTATTCATTT GAAGGACAGC 901 AGCCTGGGGA TTTGAATTTT CAAGCTGGAG ACAGAATCAC AGTTATATCA AAAACAGATT 961 CACATTTTGA TTGGTGGGAA GGAAAACTTC GAGGTCAAAC TGGCATTTTT CCAGCCAACT 1021 ACGTAACCAT GAATTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1081 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1141 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GCGACTTGCC AATGGAACAG 1201 TTTGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt