Transcript: Mouse NR_110343.1

Mus musculus Sh3 domain YSC-like 1 (Sh3yl1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2015-06-09
Taxon:
Mus musculus (mouse)
Gene:
Sh3yl1 (24057)
Length:
1892
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110343.1
NBCI Gene record:
Sh3yl1 (24057)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_110343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121471 GCCAACTATGTAACTATGAAT pLKO.1 1703 3UTR 100% 5.625 7.875 N Sh3yl1 n/a
2 TRCN0000121469 GCAGCGCATCAATTTGAAGAA pLKO.1 1357 3UTR 100% 4.950 6.930 N Sh3yl1 n/a
3 TRCN0000121468 CCAGGGTAATAGAAATGAATA pLKO.1 1474 3UTR 100% 13.200 9.240 N Sh3yl1 n/a
4 TRCN0000121470 CAGCGCATCAATTTGAAGAAA pLKO.1 1358 3UTR 100% 5.625 3.938 N Sh3yl1 n/a
5 TRCN0000121467 CACAGACAGGATTCACTGTTT pLKO.1 1773 3UTR 100% 4.950 3.465 N Sh3yl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02973 pDONR223 100% 46.6% None (many diffs) n/a
2 ccsbBroad304_02973 pLX_304 0% 46.6% V5 (many diffs) n/a
3 TRCN0000491303 CCTTCTTCCAGCGTACGAAGCAGC pLX_317 32.1% 46.6% V5 (many diffs) n/a
4 ccsbBroadEn_15789 pDONR223 0% 44.1% None (many diffs) n/a
5 ccsbBroad304_15789 pLX_304 0% 44.1% V5 (many diffs) n/a
6 TRCN0000480604 GCGACTTGCCAATGGAACAGTTTG pLX_317 51.8% 44.1% V5 (many diffs) n/a
7 ccsbBroadEn_15788 pDONR223 0% 15.6% None (many diffs) n/a
8 ccsbBroad304_15788 pLX_304 0% 15.6% V5 (many diffs) n/a
9 TRCN0000468192 CACGTACTCACAGTCCTTGGCTAC pLX_317 90.3% 15.6% V5 (many diffs) n/a
Download CSV