Transcript: Human NR_104223.1

Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
SH3YL1 (26751)
Length:
3393
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104223.1
NBCI Gene record:
SH3YL1 (26751)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276080 ATATCCGAGCTTATGACATTT pLKO_005 2220 3UTR 100% 13.200 18.480 N SH3YL1 n/a
2 TRCN0000276153 TAGAAGTGACAGCGCTGTATT pLKO_005 2529 3UTR 100% 13.200 18.480 N SH3YL1 n/a
3 TRCN0000168850 GCCAACTACGTAACCATGAAT pLKO.1 2678 3UTR 100% 5.625 7.875 N SH3YL1 n/a
4 TRCN0000173020 CCTGGACTTTCCAGCTATCAT pLKO.1 2480 3UTR 100% 5.625 3.938 N SH3YL1 n/a
5 TRCN0000276078 CCTGGACTTTCCAGCTATCAT pLKO_005 2480 3UTR 100% 5.625 3.938 N SH3YL1 n/a
6 TRCN0000168323 GTCTTTAGAAGGGAGCTGTTT pLKO.1 2158 3UTR 100% 4.950 3.465 N SH3YL1 n/a
7 TRCN0000167670 GAGCTGTTTGATTGAAAGGAA pLKO.1 2170 3UTR 100% 3.000 2.100 N SH3YL1 n/a
8 TRCN0000276150 GAGCTGTTTGATTGAAAGGAA pLKO_005 2170 3UTR 100% 3.000 2.100 N SH3YL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02973 pDONR223 100% 30.2% None 1_1673delinsA;2699_3393del n/a
2 ccsbBroad304_02973 pLX_304 0% 30.2% V5 1_1673delinsA;2699_3393del n/a
3 TRCN0000491303 CCTTCTTCCAGCGTACGAAGCAGC pLX_317 32.1% 30.2% V5 1_1673delinsA;2699_3393del n/a
4 ccsbBroadEn_15789 pDONR223 0% 28.4% None (many diffs) n/a
5 ccsbBroad304_15789 pLX_304 0% 28.4% V5 (many diffs) n/a
6 TRCN0000480604 GCGACTTGCCAATGGAACAGTTTG pLX_317 51.8% 28.4% V5 (many diffs) n/a
7 ccsbBroadEn_15788 pDONR223 0% 9.7% None (many diffs) n/a
8 ccsbBroad304_15788 pLX_304 0% 9.7% V5 (many diffs) n/a
9 TRCN0000468192 CACGTACTCACAGTCCTTGGCTAC pLX_317 90.3% 9.7% V5 (many diffs) n/a
Download CSV