Transcript: Human NM_001159597.2

Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
SH3YL1 (26751)
Length:
1777
CDS:
114..1085

Additional Resources:

NCBI RefSeq record:
NM_001159597.2
NBCI Gene record:
SH3YL1 (26751)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159597.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276080 ATATCCGAGCTTATGACATTT pLKO_005 661 CDS 100% 13.200 18.480 N SH3YL1 n/a
2 TRCN0000276153 TAGAAGTGACAGCGCTGTATT pLKO_005 913 CDS 100% 13.200 18.480 N SH3YL1 n/a
3 TRCN0000168850 GCCAACTACGTAACCATGAAT pLKO.1 1062 CDS 100% 5.625 7.875 N SH3YL1 n/a
4 TRCN0000168323 GTCTTTAGAAGGGAGCTGTTT pLKO.1 599 CDS 100% 4.950 3.465 N SH3YL1 n/a
5 TRCN0000167670 GAGCTGTTTGATTGAAAGGAA pLKO.1 611 CDS 100% 3.000 2.100 N SH3YL1 n/a
6 TRCN0000276150 GAGCTGTTTGATTGAAAGGAA pLKO_005 611 CDS 100% 3.000 2.100 N SH3YL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159597.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15789 pDONR223 0% 99.8% 100% None 279A>G n/a
2 ccsbBroad304_15789 pLX_304 0% 99.8% 100% V5 279A>G n/a
3 TRCN0000480604 GCGACTTGCCAATGGAACAGTTTG pLX_317 51.8% 99.8% 100% V5 279A>G n/a
4 ccsbBroadEn_02973 pDONR223 100% 94.4% 94.4% None 781_782ins57 n/a
5 ccsbBroad304_02973 pLX_304 0% 94.4% 94.4% V5 781_782ins57 n/a
6 TRCN0000491303 CCTTCTTCCAGCGTACGAAGCAGC pLX_317 32.1% 94.4% 94.4% V5 781_782ins57 n/a
7 ccsbBroadEn_15788 pDONR223 0% 34.1% 30% None (many diffs) n/a
8 ccsbBroad304_15788 pLX_304 0% 34.1% 30% V5 (many diffs) n/a
9 TRCN0000468192 CACGTACTCACAGTCCTTGGCTAC pLX_317 90.3% 34.1% 30% V5 (many diffs) n/a
Download CSV