Construct: ORF TRCN0000480697
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010715.1_s317c1
- Derived from:
- ccsbBroadEn_01774
- DNA Barcode:
- ACCAAGTCCTACAGAAAACTCAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WARS1 (7453)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480697
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | NM_004184.4 | 100% | 100% | |
| 2 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | NM_173701.2 | 100% | 100% | |
| 3 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | XM_005268044.4 | 100% | 100% | |
| 4 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | XM_006720249.3 | 100% | 100% | |
| 5 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | XM_011537133.2 | 100% | 100% | |
| 6 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | XM_017021627.2 | 100% | 100% | |
| 7 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | XM_017021629.1 | 100% | 100% | |
| 8 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | XM_024449706.1 | 100% | 100% | |
| 9 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | XM_024449707.1 | 100% | 100% | |
| 10 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | NM_213645.2 | 91.2% | 91.2% | 0_1ins123 |
| 11 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | NM_213646.2 | 91.2% | 91.2% | 0_1ins123 |
| 12 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | XM_011537136.3 | 91.2% | 91.2% | 0_1ins123 |
| 13 | human | 7453 | WARS1 | tryptophanyl-tRNA synthetase 1 | XM_024449708.1 | 91.2% | 91.2% | 0_1ins123 |
| 14 | mouse | 22375 | Wars | tryptophanyl-tRNA synthetase | NM_001164314.1 | 86.5% | 89.4% | (many diffs) |
| 15 | mouse | 22375 | Wars | tryptophanyl-tRNA synthetase | NM_001164488.1 | 86.5% | 89.4% | (many diffs) |
| 16 | mouse | 22375 | Wars | tryptophanyl-tRNA synthetase | NM_011710.3 | 85.4% | 88.3% | (many diffs) |
| 17 | mouse | 22375 | Wars | tryptophanyl-tRNA synthetase | XM_006515819.1 | 85.4% | 88.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1479
- ORF length:
- 1413
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc caacagtgag cccgcatctc tgctggagct gttcaacagc atcgccacac 121 aaggggagct cgtaaggtcc ctcaaagcgg gaaatgcgtc aaaggatgaa attgattctg 181 cagtaaagat gttggtgtca ttaaaaatga gctacaaagc tgccgcgggg gaggattaca 241 aggctgactg tcctccaggg aacccagcac ctaccagtaa tcatggccca gatgccacag 301 aagctgaaga ggattttgtg gacccatgga cagtacagac aagcagtgca aaaggcatag 361 actacgataa gctcattgtt cggtttggaa gtagtaaaat tgacaaagag ctaataaacc 421 gaatagagag agccaccggc caaagaccac accacttcct gcgcagaggc atcttcttct 481 cacacagaga tatgaatcag gttcttgatg cctatgaaaa taagaagcca ttttatctgt 541 acacgggccg gggcccctct tctgaagcaa tgcatgtagg tcacctcatt ccatttattt 601 tcacaaagtg gctccaggat gtatttaacg tgcccttggt catccagatg acggatgacg 661 agaagtatct gtggaaggac ctgaccctgg accaggccta tagctatgct gtggagaatg 721 ccaaggacat catcgcctgt ggctttgaca tcaacaagac tttcatattc tctgacctgg 781 actacatggg gatgagctca ggtttctaca aaaatgtggt gaagattcaa aagcatgtta 841 ccttcaacca agtgaaaggc attttcggct tcactgacag cgactgcatt gggaagatca 901 gttttcctgc catccaggct gctccctcct tcagcaactc attcccacag atcttccgag 961 acaggacgga tatccagtgc cttatcccat gtgccattga ccaggatcct tactttagaa 1021 tgacaaggga cgtcgccccc aggatcggct atcctaaacc agccctgctg cactccaccT 1081 TCTTCCCAGC CCTGCAGGGC GCCCAGACCA AAATGAGTGC CAGCGACCCC AACTCCTCCA 1141 TCTTCCTCAC CGACACGGCC AAGCAGATCA AAACCAAGGT CAATAAGCAT GCGTTTTCTG 1201 GAGGGAGAGA CACCATCGAG GAGCACAGGC AGTTTGGGGG CAACTGTGAT GTGGACGTGT 1261 CTTTCATGTA CCTGACCTTC TTCCTCGAGG ACGACGACAA GCTCGAGCAG ATCAGGAAGG 1321 ATTACACCAG CGGAGCCATG CTCACCGGTG AGCTCAAGAA GGCACTCATA GAGGTTCTGC 1381 AGCCCTTGAT CGCAGAGCAC CAGGCCCGGC GCAAGGAGGT CACGGATGAG ATAGTGAAAG 1441 AGTTCATGAC TCCCCGGAAG CTGTCCTTCG ACTTTCAGTA CCCAACTTTC TTGTACAAAG 1501 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1561 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1621 ACGAACCAAG TCCTACAGAA AACTCAAGAC GCGTTAAGTC gacaatcaac ctctggatta 1681 caaaatttgt gaaagatt