Transcript: Mouse NM_011710.3

Mus musculus tryptophanyl-tRNA synthetase (Wars), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Wars (22375)
Length:
1842
CDS:
115..1560

Additional Resources:

NCBI RefSeq record:
NM_011710.3
NBCI Gene record:
Wars (22375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076085 CACCGAGATATGAATCAAATT pLKO.1 544 CDS 100% 13.200 9.240 N Wars n/a
2 TRCN0000076084 CCACCGAGATATGAATCAAAT pLKO.1 543 CDS 100% 13.200 9.240 N Wars n/a
3 TRCN0000076086 CTTCCGAGACAGGACAGATAT pLKO.1 1014 CDS 100% 13.200 9.240 N Wars n/a
4 TRCN0000076083 CTCCACTCAGAGTCTTGGAAA pLKO.1 1690 3UTR 100% 4.950 3.465 N Wars n/a
5 TRCN0000076087 GCATATAGCTACACCGTAGAA pLKO.1 757 CDS 100% 4.950 3.465 N Wars n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01774 pDONR223 100% 85.4% 88.3% None (many diffs) n/a
2 ccsbBroad304_01774 pLX_304 0% 85.4% 88.3% V5 (many diffs) n/a
3 TRCN0000480697 ACCAAGTCCTACAGAAAACTCAAG pLX_317 28.6% 85.4% 88.3% V5 (many diffs) n/a
Download CSV