Transcript: Human NM_213645.2

Homo sapiens tryptophanyl-tRNA synthetase 1 (WARS1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
WARS1 (7453)
Length:
2470
CDS:
93..1385

Additional Resources:

NCBI RefSeq record:
NM_213645.2
NBCI Gene record:
WARS1 (7453)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_213645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045602 GTCACGGATGAGATAGTGAAA pLKO.1 1323 CDS 100% 4.950 3.960 N WARS1 n/a
2 TRCN0000291716 GTCACGGATGAGATAGTGAAA pLKO_005 1323 CDS 100% 4.950 3.960 N WARS1 n/a
3 TRCN0000045598 CCAGCACCTACCAGTAATCAT pLKO.1 168 CDS 100% 5.625 3.938 N WARS1 n/a
4 TRCN0000291715 CCAGCACCTACCAGTAATCAT pLKO_005 168 CDS 100% 5.625 3.938 N WARS1 n/a
5 TRCN0000045600 CTTTGACATCAACAAGACTTT pLKO.1 647 CDS 100% 4.950 3.465 N WARS1 n/a
6 TRCN0000307760 CTTTGACATCAACAAGACTTT pLKO_005 647 CDS 100% 4.950 3.465 N WARS1 n/a
7 TRCN0000045599 GCTGTCCTTCGACTTTCAGTA pLKO.1 1364 CDS 100% 4.950 3.465 N WARS1 n/a
8 TRCN0000291654 GCTGTCCTTCGACTTTCAGTA pLKO_005 1364 CDS 100% 4.950 3.465 N WARS1 n/a
9 TRCN0000045601 CAAAGAGCTAATAAACCGAAT pLKO.1 308 CDS 100% 4.050 2.835 N WARS1 n/a
10 TRCN0000291653 CAAAGAGCTAATAAACCGAAT pLKO_005 308 CDS 100% 4.050 2.835 N WARS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_213645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01774 pDONR223 100% 91.2% 91.2% None 0_1ins123 n/a
2 ccsbBroad304_01774 pLX_304 0% 91.2% 91.2% V5 0_1ins123 n/a
3 TRCN0000480697 ACCAAGTCCTACAGAAAACTCAAG pLX_317 28.6% 91.2% 91.2% V5 0_1ins123 n/a
Download CSV