Construct: ORF TRCN0000480756
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014866.1_s317c1
- Derived from:
- ccsbBroadEn_06946
- DNA Barcode:
- ACAGGATACATGATTACATGCCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SHMT1 (6470)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480756
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6470 | SHMT1 | serine hydroxymethyltransfe... | NM_004169.5 | 99.9% | 99.7% | 1420C>T |
| 2 | human | 6470 | SHMT1 | serine hydroxymethyltransfe... | XM_005256767.3 | 99.9% | 99.7% | 1420C>T |
| 3 | human | 6470 | SHMT1 | serine hydroxymethyltransfe... | XM_017024957.1 | 99.9% | 99.7% | 1420C>T |
| 4 | human | 6470 | SHMT1 | serine hydroxymethyltransfe... | NM_148918.2 | 91.8% | 91.7% | 813_814ins117;1303C>T |
| 5 | human | 6470 | SHMT1 | serine hydroxymethyltransfe... | XM_017024958.1 | 91.8% | 91.7% | 813_814ins117;1303C>T |
| 6 | human | 6470 | SHMT1 | serine hydroxymethyltransfe... | XM_011523992.3 | 83.3% | 83.2% | 812_813ins240;1180C>T |
| 7 | human | 6470 | SHMT1 | serine hydroxymethyltransfe... | XM_024450887.1 | 83.3% | 83.2% | 812_813ins240;1180C>T |
| 8 | human | 6470 | SHMT1 | serine hydroxymethyltransfe... | NM_001281786.1 | 71.3% | 71.2% | 0_1ins414;1006C>T |
| 9 | human | 6470 | SHMT1 | serine hydroxymethyltransfe... | XM_024450888.1 | 71.3% | 71.2% | 0_1ins414;1006C>T |
| 10 | human | 6470 | SHMT1 | serine hydroxymethyltransfe... | XM_024450889.1 | 63.2% | 63.1% | 0_1ins414;399_400ins117;889C>T |
| 11 | human | 6470 | SHMT1 | serine hydroxymethyltransfe... | XM_024450890.1 | 54.7% | 54.6% | 0_1ins414;398_399ins240;766C>T |
| 12 | mouse | 20425 | Shmt1 | serine hydroxymethyltransfe... | NM_009171.2 | 84.2% | 90% | (many diffs) |
| 13 | mouse | 20425 | Shmt1 | serine hydroxymethyltransfe... | XM_006532644.3 | 84.2% | 90% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1515
- ORF length:
- 1449
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac gatgccagtc aacggggccc acaaggatgc tgacctgtgg tcctcacatg 121 acaagatgct ggcacaaccc ctcaaagaca gtgatgttga ggtttacaac atcattaaga 181 aggagagtaa ccggcagagg gttggattgg agctgattgc ctcggagaat ttcgccagcc 241 gagcagtttt ggaggcccta ggctcttgct taaataacaa atactctgag gggtacccgg 301 gccagagata ctatggcggg actgagttta ttgatgaact ggagaccctc tgtcagaagc 361 gagccctgca ggcctataag ctggacccac agtgctgggg ggtcaacgtc cagccctact 421 caggctcccc tgcaaacttt gctgtgtaca ctgccctggt ggaaccccat gggcgcatca 481 tgggcctgga ccttccggat gggggccacc tgacccatgg gttcatgaca gacaagaaga 541 aaatctctgc cacgtccatc ttctttgaat ctatgcccta caaggtgaac ccagatactg 601 gctacatcaa ctatgaccag ctggaggaga acgcacgcct cttccacccg aagctgatca 661 tcgcaggaac cagctgctac tcccgaaacc tggaatatgc ccggctacgg aagattgcag 721 atgagaacgg ggcgtatctc atggcggaca tggctcacat cagcgggctg gtggcggctg 781 gcgtggtgcc ctccccattt gaacactgcc atgtggtgac caccaccact cacaagaccc 841 tgcgaggctg ccgagctggc atgatcttct acaggaaagg agtgaaaagt gtggatccca 901 agactggcaa agagattctg tacaacctgg agtctcttat caattctgct gtgttccctg 961 gcctgcaggg aggtccccac aaccacgcca ttgctggggt tgctgtggca ctgaagcaag 1021 ctatgactct ggaatttaaa gtttatcaac accaggtggt ggccaactgc agggctctgt 1081 ctgaggccct gacggagctg ggctacaaaa tagtcacagg tggttctgac aaccattTGA 1141 TCCTTGTGGA TCTCCGTTCC AAAGGCACAG ATGGTGGAAG GGCTGAGAAG GTGCTAGAAG 1201 CCTGTTCTAT TGCCTGCAAC AAGAACACCT GTCCAGGTGA CAGAAGCGCT CTGCGGCCCA 1261 GTGGACTGCG GCTGGGGACC CCAGCACTGA CGTCCCGTGG ACTTTTGGAA AAAGACTTCC 1321 AAAAAGTAGC CCACTTTATT CACAGAGGGA TAGAGCTGAC CCTGCAGATC CAGAGCGACA 1381 CTGGTGTCAG AGCCACCCTG AAAGAGTTCA AGGAGAGACT GGCAGGGGAT AAGTACCAGG 1441 CGGCCGTGCA GGCTCTCCGG GAGGAGGTTG AGAGCTTCGC CTCTTTCTTC CCTCTGCCTG 1501 GCCTGCCTGA CTTCTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1561 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1621 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA ACAGGATACA TGATTACATG 1681 CCCCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt