Transcript: Human XM_011523992.3

PREDICTED: Homo sapiens serine hydroxymethyltransferase 1 (SHMT1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHMT1 (6470)
Length:
2256
CDS:
177..1388

Additional Resources:

NCBI RefSeq record:
XM_011523992.3
NBCI Gene record:
SHMT1 (6470)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523992.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034766 CCTAGGCTCTTGCTTAAATAA pLKO.1 368 CDS 100% 15.000 10.500 N SHMT1 n/a
2 TRCN0000034765 CCCAGATACTGGCTACATCAA pLKO.1 701 CDS 100% 4.950 3.465 N SHMT1 n/a
3 TRCN0000034768 CTTGTGGATCTCCGTTCCAAA pLKO.1 1014 CDS 100% 4.950 3.465 N SHMT1 n/a
4 TRCN0000034767 CCACTTTATTCACAGAGGGAT pLKO.1 1202 CDS 100% 2.640 1.848 N SHMT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523992.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15587 pDONR223 0% 90.7% 90.7% None 812_813ins123 n/a
2 ccsbBroad304_15587 pLX_304 0% 90.7% 90.7% V5 812_813ins123 n/a
3 ccsbBroadEn_06946 pDONR223 100% 83.3% 83.2% None 812_813ins240;1180C>T n/a
4 ccsbBroad304_06946 pLX_304 0% 83.3% 83.2% V5 812_813ins240;1180C>T n/a
5 TRCN0000480756 ACAGGATACATGATTACATGCCCC pLX_317 26.4% 83.3% 83.2% V5 812_813ins240;1180C>T n/a
Download CSV