Transcript: Human NM_001281786.1

Homo sapiens serine hydroxymethyltransferase 1 (SHMT1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SHMT1 (6470)
Length:
2437
CDS:
510..1547

Additional Resources:

NCBI RefSeq record:
NM_001281786.1
NBCI Gene record:
SHMT1 (6470)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281786.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034764 GCAAGCTATGACTCTGGAATT pLKO.1 1046 CDS 100% 0.000 0.000 N SHMT1 n/a
2 TRCN0000034766 CCTAGGCTCTTGCTTAAATAA pLKO.1 403 5UTR 100% 15.000 10.500 N SHMT1 n/a
3 TRCN0000034765 CCCAGATACTGGCTACATCAA pLKO.1 620 CDS 100% 4.950 3.465 N SHMT1 n/a
4 TRCN0000034768 CTTGTGGATCTCCGTTCCAAA pLKO.1 1173 CDS 100% 4.950 3.465 N SHMT1 n/a
5 TRCN0000034767 CCACTTTATTCACAGAGGGAT pLKO.1 1361 CDS 100% 2.640 1.848 N SHMT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281786.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06946 pDONR223 100% 71.3% 71.2% None 0_1ins414;1006C>T n/a
2 ccsbBroad304_06946 pLX_304 0% 71.3% 71.2% V5 0_1ins414;1006C>T n/a
3 TRCN0000480756 ACAGGATACATGATTACATGCCCC pLX_317 26.4% 71.3% 71.2% V5 0_1ins414;1006C>T n/a
4 ccsbBroadEn_15587 pDONR223 0% 63.3% 63.3% None 0_1ins414;400_516del n/a
5 ccsbBroad304_15587 pLX_304 0% 63.3% 63.3% V5 0_1ins414;400_516del n/a
Download CSV