Transcript: Human XM_005252638.4

PREDICTED: Homo sapiens cell division cycle 123 (CDC123), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDC123 (8872)
Length:
1222
CDS:
56..970

Additional Resources:

NCBI RefSeq record:
XM_005252638.4
NBCI Gene record:
CDC123 (8872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252638.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256622 CACACAATACTATGATCATAT pLKO_005 544 CDS 100% 13.200 18.480 N CDC123 n/a
2 TRCN0000215432 GAAGACTTTGTGTTCGATATA pLKO.1 641 CDS 100% 13.200 18.480 N Cdc123 n/a
3 TRCN0000160875 GAACAACTTAAACGGCGATTT pLKO.1 760 CDS 100% 10.800 15.120 N CDC123 n/a
4 TRCN0000158552 CCGTTTATTCATTGTACTGAT pLKO.1 398 CDS 100% 4.950 6.930 N CDC123 n/a
5 TRCN0000164398 CGCTCACAAGCTAATAGACTT pLKO.1 913 CDS 100% 4.950 6.930 N CDC123 n/a
6 TRCN0000165101 CCCTATTTGAGTTACCGGCTA pLKO.1 857 CDS 100% 2.160 3.024 N CDC123 n/a
7 TRCN0000162968 GAGAACAACTTAAACGGCGAT pLKO.1 758 CDS 100% 2.160 3.024 N CDC123 n/a
8 TRCN0000256629 CTCAGAATGTGAAGGATTATT pLKO_005 147 CDS 100% 15.000 12.000 N CDC123 n/a
9 TRCN0000158612 CGTATTGGATAGCAATGAATA pLKO.1 297 CDS 100% 13.200 10.560 N CDC123 n/a
10 TRCN0000246989 AGACTTTGTGTTCGATATATA pLKO_005 643 CDS 100% 15.000 10.500 N Cdc123 n/a
11 TRCN0000256621 AGACTTTGTGTTCGATATATA pLKO_005 643 CDS 100% 15.000 10.500 N CDC123 n/a
12 TRCN0000256626 CCAGATCCATGTATAGAATAT pLKO_005 425 CDS 100% 13.200 9.240 N CDC123 n/a
13 TRCN0000256624 ACATACAGTACAAATTCTTAG pLKO_005 618 CDS 100% 10.800 7.560 N CDC123 n/a
14 TRCN0000256627 CACCTGGGAAGAACTGATATC pLKO_005 736 CDS 100% 10.800 7.560 N CDC123 n/a
15 TRCN0000256623 CCAGCTTTCCGTTGCACAAAC pLKO_005 812 CDS 100% 10.800 7.560 N CDC123 n/a
16 TRCN0000215717 CTCATTGACTTTAATCCATTT pLKO.1 689 CDS 100% 10.800 7.560 N Cdc123 n/a
17 TRCN0000246990 CTCATTGACTTTAATCCATTT pLKO_005 689 CDS 100% 10.800 7.560 N Cdc123 n/a
18 TRCN0000162092 CTCCAGATCCATGTATAGAAT pLKO.1 423 CDS 100% 5.625 3.938 N CDC123 n/a
19 TRCN0000164183 CGATTTCATCACTCGTGACTT pLKO.1 370 CDS 100% 4.950 3.465 N CDC123 n/a
20 TRCN0000265801 CTTCCGAGGCGTTACCATCAA pLKO_005 106 CDS 100% 4.950 3.465 N CDC123 n/a
21 TRCN0000158763 GCTCATTGACTTTAATCCATT pLKO.1 688 CDS 100% 4.950 3.465 N CDC123 n/a
22 TRCN0000158764 GACTTTAATCCATTTGGTGAA pLKO.1 695 CDS 100% 4.050 2.835 N CDC123 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252638.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02035 pDONR223 100% 90.4% 90.4% None 236_237ins96 n/a
2 ccsbBroad304_02035 pLX_304 0% 90.4% 90.4% V5 236_237ins96 n/a
3 TRCN0000480768 GCTTCAGACCTGTGGTAAGAAAAT pLX_317 45.2% 90.4% 90.4% V5 236_237ins96 n/a
Download CSV