Transcript: Mouse XM_006497564.1

PREDICTED: Mus musculus cell division cycle 123 (Cdc123), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdc123 (98828)
Length:
1220
CDS:
52..1029

Additional Resources:

NCBI RefSeq record:
XM_006497564.1
NBCI Gene record:
Cdc123 (98828)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257586 GACTTCACACAGCCGTTTATT pLKO_005 445 CDS 100% 15.000 21.000 N Cdc123 n/a
2 TRCN0000215717 CTCATTGACTTTAATCCATTT pLKO.1 748 CDS 100% 10.800 15.120 N Cdc123 n/a
3 TRCN0000246990 CTCATTGACTTTAATCCATTT pLKO_005 748 CDS 100% 10.800 15.120 N Cdc123 n/a
4 TRCN0000158763 GCTCATTGACTTTAATCCATT pLKO.1 747 CDS 100% 4.950 6.930 N CDC123 n/a
5 TRCN0000246989 AGACTTTGTGTTCGATATATA pLKO_005 702 CDS 100% 15.000 12.000 N Cdc123 n/a
6 TRCN0000256621 AGACTTTGTGTTCGATATATA pLKO_005 702 CDS 100% 15.000 12.000 N CDC123 n/a
7 TRCN0000215432 GAAGACTTTGTGTTCGATATA pLKO.1 700 CDS 100% 13.200 10.560 N Cdc123 n/a
8 TRCN0000246991 AGTCCAAGAAGCTATCAATTC pLKO_005 285 CDS 100% 10.800 8.640 N Cdc123 n/a
9 TRCN0000184806 CGAAGCCTTACCATCAAGAGT pLKO.1 106 CDS 100% 3.000 2.400 N Cdc123 n/a
10 TRCN0000257596 AGGGCCTTTGGTACTTGTAAA pLKO_005 1167 3UTR 100% 13.200 9.240 N Cdc123 n/a
11 TRCN0000256622 CACACAATACTATGATCATAT pLKO_005 603 CDS 100% 13.200 9.240 N CDC123 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02035 pDONR223 100% 85% 89.2% None (many diffs) n/a
2 ccsbBroad304_02035 pLX_304 0% 85% 89.2% V5 (many diffs) n/a
3 TRCN0000480768 GCTTCAGACCTGTGGTAAGAAAAT pLX_317 45.2% 85% 89.2% V5 (many diffs) n/a
Download CSV