Construct: ORF TRCN0000480772
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008837.5_s317c1
- Derived from:
- ccsbBroadEn_14899
- DNA Barcode:
- CTCCATTTCTTCTAAATTGTACCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIK3R3 (8503)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480772
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NM_001114172.1 | 99.9% | 99.7% | 1013A>C |
2 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NM_003629.4 | 99.9% | 99.7% | 1013A>C |
3 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NM_001303428.1 | 96.3% | 96.2% | 1_51del;1064A>C |
4 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NM_001328648.1 | 90.3% | 90.2% | 0_1ins132;881A>C |
5 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NM_001328649.1 | 90.3% | 90.2% | 0_1ins132;881A>C |
6 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NM_001328650.1 | 90.3% | 90.2% | 0_1ins132;881A>C |
7 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NM_001328651.1 | 90.3% | 90.2% | 0_1ins132;881A>C |
8 | human | 110117499 | LOC110117498-PIK3R3 | LOC110117498-PIK3R3 readthr... | NM_001303427.2 | 87.9% | 81.3% | (many diffs) |
9 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NM_001328652.2 | 87.5% | 87.4% | 1013A>C;1016_1017ins171 |
10 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NM_001303429.2 | 87.1% | 86.9% | 764_765ins177;836A>C |
11 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NM_001328653.2 | 82.3% | 82.2% | 0_1ins243;770A>C |
12 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NM_001328654.2 | 66% | 65.9% | 0_1ins468;545A>C |
13 | human | 8503 | PIK3R3 | phosphoinositide-3-kinase r... | NR_137329.2 | 21.4% | (many diffs) | |
14 | mouse | 18710 | Pik3r3 | phosphoinositide-3-kinase r... | NM_181585.5 | 91.7% | 95.6% | (many diffs) |
15 | mouse | 18710 | Pik3r3 | phosphoinositide-3-kinase r... | XM_017320039.1 | 91.7% | 95.6% | (many diffs) |
16 | mouse | 18710 | Pik3r3 | phosphoinositide-3-kinase r... | XM_017320040.1 | 91.7% | 95.6% | (many diffs) |
17 | mouse | 18710 | Pik3r3 | phosphoinositide-3-kinase r... | XM_006502859.3 | 86.3% | 76.2% | (many diffs) |
18 | mouse | 18710 | Pik3r3 | phosphoinositide-3-kinase r... | XM_006502860.3 | 86.3% | 76.2% | (many diffs) |
19 | mouse | 18710 | Pik3r3 | phosphoinositide-3-kinase r... | XM_017320041.1 | 82.2% | 86.1% | (many diffs) |
20 | mouse | 18710 | Pik3r3 | phosphoinositide-3-kinase r... | XM_006502861.2 | 80.4% | 83.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1449
- ORF length:
- 1383
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgta caatacggtg tggagtatgg accgcgatga cgcagactgg agggaggtga 121 tgatgcccta ttcgacagaa ctgatatttt atattgaaat ggatcctcca gctcttccac 181 caaagccacc taagccaatg acttcagcag ttccaaatgg aatgaaggac agttctgttt 241 ctcttcagga tgcagaatgg tactgggggg atatttcaag ggaggaggta aatgacaaat 301 tgcgggatat gccagatggg accttcttgg tccgagatgc ctcaacaaaa atgcagggag 361 attatacttt gactttgcgg aagggaggca ataataagtt aataaagatc tatcaccggg 421 atggtaaata tggcttttct gatcctctga catttaattc cgtggtggag ctcattaacc 481 actatcacca tgaatctctt gctcagtaca atcccaaact tgatgtgaag ctgatgtacc 541 cagtgtccag ataccaacag gatcagttgg taaaagaaga taatattgat gcagtaggta 601 aaaaactgca agaataccac tctcagtatc aggagaagag taaagagtat gataggctgt 661 atgaagaata tactagaaca tcccaggaaa tacagatgaa gaggactgca atagaagctt 721 ttaatgaaac aattaaaata tttgaagagc agtgtcacac acaagaacaa catagcaaag 781 aatatattga gcgatttcgc agagagggga atgaaaagga gattgaacga attatgatga 841 attatgataa attgaaatca cgtctgggtg agattcatga tagcaaaatg cgtctagagc 901 aggatttgaa gaatcaagct ttggacaacc gagaaataga taaaaaaatg aatagcatca 961 aacctgacct gatccagctg cgaaagatcc gagatcaaca ccttgtatgg ctcaatcaca 1021 aaggagtgag acagaaacgc ctgaatgtct ggctgggaat taagaatgag gatgcTGCTG 1081 AGAACTATTT TATCAATGAG GAAGATGAAA ACCTGCCCCA TTATGATGAG AAAACCTGGT 1141 TTGTTGAGGA TATCAATCGA GTACAAGCAG AGGACTTGCT TTATGGGAAA CCTGATGGTG 1201 CATTCTTAAT TCGTGAGAGT AGCAAGAAAG GATGCTATGC TTGCTCTGTG GTGGCCGATG 1261 GGGAAGTGAA GCACTGTGTG ATCTACAGCA CTGCTCGGGG CTATGGCTTT GCAGAGCCCT 1321 ACAACCTGTA CAGCTCTCTG AAGGAGCTAG TGCTCCATTA CCAGCAGACA TCCTTGGTTC 1381 AGCACAACGA CTCCCTCAAC GTCAGGCTTG CCTACCCTGT TCATGCACAG ATGCCCTCGC 1441 TTTGCAGATA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1501 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1561 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACTCCAT TTCTTCTAAA TTGTACCAAC 1621 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt