Transcript: Human NM_001328651.1

Homo sapiens phosphoinositide-3-kinase regulatory subunit 3 (PIK3R3), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
PIK3R3 (8503)
Length:
4864
CDS:
78..1331

Additional Resources:

NCBI RefSeq record:
NM_001328651.1
NBCI Gene record:
PIK3R3 (8503)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001328651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195110 CAACCTCGTTTCCTTACAAAT pLKO.1 4506 3UTR 100% 13.200 6.600 Y PIK3R3 n/a
2 TRCN0000195144 CAGTCCTACATTCCTTCATTT pLKO.1 3606 3UTR 100% 13.200 6.600 Y PIK3R3 n/a
3 TRCN0000033290 GCTTTGGACAACCGAGAAATA pLKO.1 798 CDS 100% 13.200 6.600 Y PIK3R3 n/a
4 TRCN0000197032 GCTGAGTGAAGCTAGGCAAAT pLKO.1 2771 3UTR 100% 10.800 5.400 Y PIK3R3 n/a
5 TRCN0000195671 CCTGGTTTGTTGAGGATATCA pLKO.1 1015 CDS 100% 5.625 2.813 Y PIK3R3 n/a
6 TRCN0000033293 GAGAAGAGTAAAGAGTATGAT pLKO.1 513 CDS 100% 5.625 2.813 Y PIK3R3 n/a
7 TRCN0000033289 GCTCAGTACAATCCCAAACTT pLKO.1 381 CDS 100% 5.625 2.813 Y PIK3R3 n/a
8 TRCN0000033292 CATTCTTAATTCGTGAGAGTA pLKO.1 1081 CDS 100% 4.950 2.475 Y PIK3R3 n/a
9 TRCN0000025093 CCAACAGGATCAGTTGGTAAA pLKO.1 434 CDS 100% 1.080 0.540 Y Pik3r3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001328651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07249 pDONR223 100% 90.3% 90.2% None 0_1ins132;881A>C n/a
2 ccsbBroad304_07249 pLX_304 0% 90.3% 90.2% V5 0_1ins132;881A>C n/a
3 TRCN0000478621 TAGACCCCGAATACATCTAAATCC pLX_317 24.3% 90.3% 90.2% V5 0_1ins132;881A>C n/a
4 ccsbBroadEn_14899 pDONR223 0% 90.3% 90.2% None 0_1ins132;881A>C n/a
5 ccsbBroad304_14899 pLX_304 0% 90.3% 90.2% V5 0_1ins132;881A>C n/a
6 TRCN0000480772 CTCCATTTCTTCTAAATTGTACCA pLX_317 27.3% 90.3% 90.2% V5 0_1ins132;881A>C n/a
Download CSV