Transcript: Mouse XM_006502861.2

PREDICTED: Mus musculus phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 (p55) (Pik3r3), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pik3r3 (18710)
Length:
5158
CDS:
720..1934

Additional Resources:

NCBI RefSeq record:
XM_006502861.2
NBCI Gene record:
Pik3r3 (18710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361422 GAGCGAATTATGATGAATTAT pLKO_005 1479 CDS 100% 15.000 21.000 N Pik3r3 n/a
2 TRCN0000361423 TATTCGACAGAACTGATATTT pLKO_005 783 CDS 100% 15.000 21.000 N Pik3r3 n/a
3 TRCN0000025089 CGAGCGAATTATGATGAATTA pLKO.1 1478 CDS 100% 13.200 18.480 N Pik3r3 n/a
4 TRCN0000025090 GCCCTATTCGACAGAACTGAT pLKO.1 779 CDS 100% 4.950 6.930 N Pik3r3 n/a
5 TRCN0000361352 CTTCTGTGGTGGAGCTTATTA pLKO_005 1111 CDS 100% 15.000 10.500 N Pik3r3 n/a
6 TRCN0000033291 CCTATTCGACAGAACTGATAT pLKO.1 781 CDS 100% 13.200 9.240 N PIK3R3 n/a
7 TRCN0000025093 CCAACAGGATCAGTTGGTAAA pLKO.1 1208 CDS 100% 1.080 0.756 N Pik3r3 n/a
8 TRCN0000033289 GCTCAGTACAATCCCAAACTT pLKO.1 1155 CDS 100% 5.625 3.938 N PIK3R3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07249 pDONR223 100% 80.4% 83.2% None (many diffs) n/a
2 ccsbBroad304_07249 pLX_304 0% 80.4% 83.2% V5 (many diffs) n/a
3 TRCN0000478621 TAGACCCCGAATACATCTAAATCC pLX_317 24.3% 80.4% 83.2% V5 (many diffs) n/a
4 ccsbBroadEn_14899 pDONR223 0% 80.4% 83.2% None (many diffs) n/a
5 ccsbBroad304_14899 pLX_304 0% 80.4% 83.2% V5 (many diffs) n/a
6 TRCN0000480772 CTCCATTTCTTCTAAATTGTACCA pLX_317 27.3% 80.4% 83.2% V5 (many diffs) n/a
Download CSV