Construct: ORF TRCN0000480911
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002850.1_s317c1
- Derived from:
- ccsbBroadEn_01288
- DNA Barcode:
- CAGAATACCCAACGATACATTCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MAPK9 (5601)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480911
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_001364608.2 | 100% | 100% | |
| 2 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_002752.5 | 100% | 100% | |
| 3 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_001364609.2 | 97.6% | 97.8% | (many diffs) |
| 4 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_139070.3 | 97.6% | 97.8% | (many diffs) |
| 5 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_001364611.2 | 92.3% | 90.3% | (many diffs) |
| 6 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_001364612.1 | 92.3% | 90.3% | (many diffs) |
| 7 | human | 5601 | MAPK9 | mitogen-activated protein k... | XM_005265940.5 | 92.3% | 90.3% | (many diffs) |
| 8 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_001364613.2 | 90% | 88.2% | (many diffs) |
| 9 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_001364607.2 | 89.3% | 88.9% | 1130_1134delCAGCA;1146_1147ins131 |
| 10 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_139068.3 | 89.3% | 88.9% | 1130_1134delCAGCA;1146_1147ins131 |
| 11 | human | 5601 | MAPK9 | mitogen-activated protein k... | XM_017009642.1 | 89% | 88.9% | 1133G>A;1134_1135ins138 |
| 12 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_139069.3 | 87% | 86.7% | (many diffs) |
| 13 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_001135044.2 | 55.4% | 54.7% | (many diffs) |
| 14 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_001364610.2 | 55.4% | 54.7% | (many diffs) |
| 15 | human | 5601 | MAPK9 | mitogen-activated protein k... | NM_001308244.1 | 49.9% | 48.1% | (many diffs) |
| 16 | human | 5601 | MAPK9 | mitogen-activated protein k... | XM_017009643.1 | 49.9% | 48.1% | (many diffs) |
| 17 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_017008454.2 | 35.4% | 41.1% | (many diffs) |
| 18 | human | 5602 | MAPK10 | mitogen-activated protein k... | XM_024454149.1 | 35.4% | 41.1% | (many diffs) |
| 19 | mouse | 26420 | Mapk9 | mitogen-activated protein k... | NM_207692.2 | 91.1% | 98.8% | (many diffs) |
| 20 | mouse | 26420 | Mapk9 | mitogen-activated protein k... | NM_001163671.1 | 89% | 96.6% | (many diffs) |
| 21 | mouse | 26420 | Mapk9 | mitogen-activated protein k... | XM_017314562.2 | 85.6% | 89.4% | (many diffs) |
| 22 | mouse | 26420 | Mapk9 | mitogen-activated protein k... | XM_017314563.2 | 83.5% | 87.3% | (many diffs) |
| 23 | mouse | 26420 | Mapk9 | mitogen-activated protein k... | NM_001163672.1 | 81.5% | 88.2% | (many diffs) |
| 24 | mouse | 26420 | Mapk9 | mitogen-activated protein k... | NM_016961.3 | 79.5% | 86% | (many diffs) |
| 25 | mouse | 26420 | Mapk9 | mitogen-activated protein k... | XM_030246022.1 | 76% | 78.8% | (many diffs) |
| 26 | mouse | 26420 | Mapk9 | mitogen-activated protein k... | XM_030246023.1 | 73.9% | 76.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1338
- ORF length:
- 1272
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cgacagtaaa tgtgacagtc agttttatag tgtgcaagtg gcagactcaa 121 ccttcactgt cctaaaacgt taccagcagc tgaaaccaat tggctctggg gcccaaggga 181 ttgtttgtgc tgcatttgat acagttcttg ggataaatgt tgcagtcaag aaactaagcc 241 gtccttttca gaaccaaact catgcaaaga gagcttatcg tgaacttgtc ctcttaaaat 301 gtgtcaatca taaaaatata attagtttgt taaatgtgtt tacaccacaa aaaactctag 361 aagaatttca agatgtgtat ttggttatgg aattaatgga tgctaactta tgtcaggtta 421 ttcacatgga gctggatcat gaaagaatgt cctaccttct ttaccagatg ctttgtggta 481 ttaaacatct gcattcagct ggtataattc atagagattt gaagcctagc aacattgttg 541 tgaaatcaga ctgcaccctg aagatccttg actttggcct ggcccggaca gcgtgcacta 601 acttcatgat gaccccttac gtggtgacac ggtactaccg ggcgcccgaa gtcatcctgg 661 gtatgggcta caaagagaac gttgatatct ggtcagtggg ttgcatcatg ggagagctgg 721 tgaaaggttg tgtgatattc caaggcactg accatattga tcagtggaat aaagttattg 781 agcagctggg aacaccatca gcagagttca tgaagaaact tcagccaact gtgaggaatt 841 atgtcgaaaa cagaccaaag tatcctggaa tcaaatttga agaactcttt ccagattgga 901 tattcccatc agaatcTGAG CGAGACAAAA TAAAAACAAG TCAAGCCAGA GATCTGTTAT 961 CAAAAATGTT AGTGATTGAT CCTGACAAGC GGATCTCTGT AGACGAAGCT CTGCGTCACC 1021 CATACATCAC TGTTTGGTAT GACCCCGCCG AAGCAGAAGC CCCACCACCT CAAATTTATG 1081 ATGCCCAGTT GGAAGAAAGA GAACATGCAA TTGAAGAATG GAAAGAGCTA ATTTACAAAG 1141 AAGTCATGGA TTGGGAAGAA AGAAGCAAGA ATGGTGTTGT AAAAGATCAG CCTTCAGATG 1201 CAGCAGTAAG TAGCAACGCC ACTCCTTCTC AGTCTTCATC GATCAATGAC ATTTCATCCA 1261 TGTCCACTGA GCAGACGCTG GCCTCAGACA CAGACAGCAG TCTTGATGCC TCGACGGGAC 1321 CCCTTGAAGG CTGTCGATGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1381 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1441 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACAGAATA CCCAACGATA 1501 CATTCTGACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt