Transcript: Mouse NM_207692.2

Mus musculus mitogen-activated protein kinase 9 (Mapk9), transcript variant alpha2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Mapk9 (26420)
Length:
4677
CDS:
274..1545

Additional Resources:

NCBI RefSeq record:
NM_207692.2
NBCI Gene record:
Mapk9 (26420)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012590 GCCTAGCAACATTGTAGTAAA pLKO.1 732 CDS 100% 13.200 18.480 N Mapk9 n/a
2 TRCN0000348050 GCCTAGCAACATTGTAGTAAA pLKO_005 732 CDS 100% 13.200 18.480 N Mapk9 n/a
3 TRCN0000055276 GCTAGTGATTGATCCAGACAA pLKO.1 1176 CDS 100% 4.950 6.930 N Mapk9 n/a
4 TRCN0000012588 CTACTCCTTCTCAGTCGTCAT pLKO.1 1424 CDS 100% 4.050 5.670 N Mapk9 n/a
5 TRCN0000348051 CTACTCCTTCTCAGTCGTCAT pLKO_005 1424 CDS 100% 4.050 5.670 N Mapk9 n/a
6 TRCN0000055277 CAGACCAAAGTACCCTGGAAT pLKO.1 1059 CDS 100% 4.950 3.960 N Mapk9 n/a
7 TRCN0000333881 CAGACCAAAGTACCCTGGAAT pLKO_005 1059 CDS 100% 4.950 3.960 N Mapk9 n/a
8 TRCN0000194759 CTAACTTATGTCAGGTTATTC pLKO.1 611 CDS 100% 13.200 9.240 N MAPK9 n/a
9 TRCN0000012592 CTCAACTTTCACTGTTCTAAA pLKO.1 324 CDS 100% 13.200 9.240 N Mapk9 n/a
10 TRCN0000348049 CTCAACTTTCACTGTTCTAAA pLKO_005 324 CDS 100% 13.200 9.240 N Mapk9 n/a
11 TRCN0000055274 GCTAACTTATGTCAGGTTATT pLKO.1 610 CDS 100% 13.200 9.240 N Mapk9 n/a
12 TRCN0000055273 CCACAGAACTTCACCTTCTTT pLKO.1 2356 3UTR 100% 5.625 3.938 N Mapk9 n/a
13 TRCN0000012589 CCCGTATATTACTGTTTGGTA pLKO.1 1227 CDS 100% 3.000 2.100 N Mapk9 n/a
14 TRCN0000055275 GCGGACTCAACTTTCACTGTT pLKO.1 319 CDS 100% 4.950 2.970 N Mapk9 n/a
15 TRCN0000195720 CTCTTTCCAGATTGGATATTC pLKO.1 1093 CDS 100% 13.200 9.240 N MAPK9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01288 pDONR223 100% 91.1% 98.8% None (many diffs) n/a
2 ccsbBroad304_01288 pLX_304 44% 91.1% 98.8% V5 (many diffs) n/a
3 TRCN0000480911 CAGAATACCCAACGATACATTCTG pLX_317 33.4% 91.1% 98.8% V5 (many diffs) n/a
4 ccsbBroadEn_14804 pDONR223 0% 91.1% 98.8% None (many diffs) n/a
5 ccsbBroad304_14804 pLX_304 53% 91.1% 98.8% V5 (many diffs) n/a
6 TRCN0000489159 CACCGTTCCCTTAACTTATACAAG pLX_317 28.3% 88.9% 96.6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000488649 ATTTTTTTCGCCTTTTGACGAGTG pLX_317 28.1% 88.8% 96.4% V5 (many diffs) n/a
8 TRCN0000488247 CCACAATTTAAGCACACACTTCTA pLX_317 27.5% 79.5% 86.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV