Transcript: Human XM_017009643.1

PREDICTED: Homo sapiens mitogen-activated protein kinase 9 (MAPK9), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAPK9 (5601)
Length:
2340
CDS:
168..812

Additional Resources:

NCBI RefSeq record:
XM_017009643.1
NBCI Gene record:
MAPK9 (5601)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147687 AGTACCGTGTCACCACGTAA pXPR_003 GGG 554 86% 6 0.6727 MAPK9 MAPK9 76720
2 BRDN0001146002 CTTATGTCAGGTTATTCACA pXPR_003 TGG 358 56% 5 0.2941 MAPK9 MAPK9 76719
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194759 CTAACTTATGTCAGGTTATTC pLKO.1 505 CDS 100% 13.200 18.480 N MAPK9 n/a
2 TRCN0000055274 GCTAACTTATGTCAGGTTATT pLKO.1 504 CDS 100% 13.200 18.480 N Mapk9 n/a
3 TRCN0000196281 GCTGGTATAATTCATAGAGAT pLKO.1 600 CDS 100% 4.950 6.930 N MAPK9 n/a
4 TRCN0000010277 ATCGTGAACTTGTCCTCTTAA pLKO.1 379 CDS 100% 13.200 9.240 N MAPK9 n/a
5 TRCN0000000946 AGGGATTGTTTGTGCTGCATT pLKO.1 278 CDS 100% 4.950 3.465 N MAPK9 n/a
6 TRCN0000001015 AGGGATTGTTTGTGCTGCATT pLKO.1 278 CDS 100% 4.950 3.465 N MAPK9 n/a
7 TRCN0000195179 CCTAGCAACATTGTTGTGAAA pLKO.1 627 CDS 100% 4.950 3.465 N MAPK9 n/a
8 TRCN0000000944 GATGTGTATTTGGTTATGGAA pLKO.1 474 CDS 100% 3.000 2.100 N MAPK9 n/a
9 TRCN0000001013 GATGTGTATTTGGTTATGGAA pLKO.1 474 CDS 100% 3.000 2.100 N MAPK9 n/a
10 TRCN0000010276 ATTTGATACAGTTCTTGGGAT pLKO.1 296 CDS 100% 2.640 1.848 N MAPK9 n/a
11 TRCN0000000947 GTTATTCACATGGAGCTGGAT pLKO.1 519 CDS 100% 2.640 1.848 N MAPK9 n/a
12 TRCN0000001016 GTTATTCACATGGAGCTGGAT pLKO.1 519 CDS 100% 2.640 1.848 N MAPK9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488247 CCACAATTTAAGCACACACTTCTA pLX_317 27.5% 54.2% 53.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_01288 pDONR223 100% 49.9% 48.1% None (many diffs) n/a
3 ccsbBroad304_01288 pLX_304 44% 49.9% 48.1% V5 (many diffs) n/a
4 TRCN0000480911 CAGAATACCCAACGATACATTCTG pLX_317 33.4% 49.9% 48.1% V5 (many diffs) n/a
5 ccsbBroadEn_14804 pDONR223 0% 49.9% 48.1% None (many diffs) n/a
6 ccsbBroad304_14804 pLX_304 53% 49.9% 48.1% V5 (many diffs) n/a
7 TRCN0000489159 CACCGTTCCCTTAACTTATACAAG pLX_317 28.3% 49% 48.1% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488649 ATTTTTTTCGCCTTTTGACGAGTG pLX_317 28.1% 48.9% 48% V5 (many diffs) n/a
Download CSV