Construct: ORF TRCN0000481056
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003388.1_s317c1
- Derived from:
- ccsbBroadEn_02932
- DNA Barcode:
- ACTCTGTGCATTCTGCAGGATTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXL3 (26224)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481056
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26224 | FBXL3 | F-box and leucine rich repe... | NM_012158.4 | 100% | 100% | |
| 2 | human | 26224 | FBXL3 | F-box and leucine rich repe... | XM_005266336.1 | 100% | 100% | |
| 3 | human | 26224 | FBXL3 | F-box and leucine rich repe... | XM_005266337.3 | 64.4% | 64.4% | 0_1ins456 |
| 4 | human | 26224 | FBXL3 | F-box and leucine rich repe... | XM_017020538.2 | 54.7% | 51.8% | (many diffs) |
| 5 | mouse | 50789 | Fbxl3 | F-box and leucine-rich repe... | NM_015822.2 | 89.2% | 97.1% | (many diffs) |
| 6 | mouse | 50789 | Fbxl3 | F-box and leucine-rich repe... | XM_006519239.3 | 89.2% | 97.1% | (many diffs) |
| 7 | mouse | 50789 | Fbxl3 | F-box and leucine-rich repe... | XM_006519241.3 | 89.2% | 97.1% | (many diffs) |
| 8 | mouse | 50789 | Fbxl3 | F-box and leucine-rich repe... | NM_001347600.1 | 78.8% | 85.9% | (many diffs) |
| 9 | mouse | 50789 | Fbxl3 | F-box and leucine-rich repe... | NM_001347601.1 | 78.8% | 85.9% | (many diffs) |
| 10 | mouse | 50789 | Fbxl3 | F-box and leucine-rich repe... | XM_006519240.3 | 78.8% | 85.9% | (many diffs) |
| 11 | mouse | 50789 | Fbxl3 | F-box and leucine-rich repe... | XM_006519243.3 | 58.1% | 64.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1350
- ORF length:
- 1284
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa acgaggagga agagatagtg accgtaattc atcagaagaa ggaactgcag 121 agaaatccaa gaaactgagg actacaaatg agcattctca gacttgtgat tggggtaatc 181 tccttcagga cattattctc caagtattta aatatttgcc tcttcttgac cgggctcatg 241 cttcacaagt ttgccgcaac tggaaccagg tatttcacat gcctgacttg tggagatgtt 301 ttgaatttga actgaatcag ccagctacat cttatttgaa agctacccat ccagagctga 361 tcaaacagat tattaaaaga cattcaaacc atctacaata tgtcagcttc aaggtggaca 421 gcagcaagga atcagctgaa gcagcttgtg atatactatc gcaacttgtg aattgctctt 481 taaaaacact tggacttatt tcaactgctc gaccaagctt tatggattta ccaaagtctc 541 actttatctc tgcactgaca gttgtgttcg taaactccaa atccctgtct tcgcttaaga 601 tagatgatac tccagtagat gatccatctc tcaaagtact agtggccaac aatagtgata 661 cactcaagct gttgaaaatg agcagctgtc ctcatgtctc tccagcaggt atcctttgtg 721 tggctgatca gtgtcacggc ttaagagaac tagccctgaa ctaccactta ttgagtgatg 781 agttgttact tgcattgtct tctgaaaaac atgttcgatt agaacatttg cgcattgatg 841 tagtcagtga gaatcctgga cagacacact tccatactat tcagaagagt agctgggatg 901 ctttcatcag acattcaccc aaagtgaact tagtgatgta ttttttttta tatgaagaag 961 aatttgaccc cttctttcgc tatgaaatac ctgccaccca tctgtacttt gggagatcag 1021 taagcaaaga tgtgcttggc cgtgtgggaa tgacatgccc tagactggtt gaactagtag 1081 tgtgtgcaaa tggattacgg ccacttgatg aagagttaat tcgcattgca gaacgttgca 1141 aaaatttgtc agctattgga ctaggggaat gtgaagtctc atgtagtgcc tttgttgagt 1201 ttgtGAAGAT GTGTGGTGGC CGCCTATCTC AATTATCCAT TATGGAAGAA GTACTAATTC 1261 CTGACCAAAA GTATAGTTTG GAGCAGATTC ACTGGGAAGT GTCCAAGCAT CTTGGTAGGG 1321 TGTGGTTTCC CGACATGATG CCCACTTGGT ACCCAACTTT CTTGTACAAA GTGGTTGATA 1381 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1441 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAACTCT 1501 GTGCATTCTG CAGGATTACA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1561 tgaaagatt