Transcript: Human XM_005266336.1

PREDICTED: Homo sapiens F-box and leucine rich repeat protein 3 (FBXL3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXL3 (26224)
Length:
3326
CDS:
155..1441

Additional Resources:

NCBI RefSeq record:
XM_005266336.1
NBCI Gene record:
FBXL3 (26224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364483 CGCAACTGGAACCAGGTATTT pLKO_005 344 CDS 100% 13.200 18.480 N FBXL3 n/a
2 TRCN0000004281 CGGATGTGAAATAACCAGTTA pLKO.1 1675 3UTR 100% 4.950 6.930 N FBXL3 n/a
3 TRCN0000004283 CGATTAGAACATTTGCGCATT pLKO.1 905 CDS 100% 4.050 5.670 N FBXL3 n/a
4 TRCN0000364484 CCTATCTCAATTATCCATTAT pLKO_005 1312 CDS 100% 13.200 10.560 N FBXL3 n/a
5 TRCN0000369033 AGCAGTCATATCTCCGAATTT pLKO_005 1640 3UTR 100% 13.200 9.240 N FBXL3 n/a
6 TRCN0000364482 ATATCCAAGAAGTACTAATAG pLKO_005 1746 3UTR 100% 13.200 9.240 N FBXL3 n/a
7 TRCN0000369032 GACATTATTCTCCAAGTATTT pLKO_005 278 CDS 100% 13.200 9.240 N FBXL3 n/a
8 TRCN0000369031 CTGATCAGTGTCACGGCTTAA pLKO_005 813 CDS 100% 10.800 7.560 N FBXL3 n/a
9 TRCN0000004284 GCCAGCTACATCTTATTTGAA pLKO.1 409 CDS 100% 5.625 3.938 N FBXL3 n/a
10 TRCN0000004285 GCCTGACTTGTGGAGATGTTT pLKO.1 370 CDS 100% 5.625 3.938 N FBXL3 n/a
11 TRCN0000004282 CCAAGAAACTGAGGACTACAA pLKO.1 216 CDS 100% 4.950 2.970 N FBXL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02932 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02932 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481056 ACTCTGTGCATTCTGCAGGATTAC pLX_317 11.9% 100% 100% V5 n/a
Download CSV