Transcript: Human XM_005266337.3

PREDICTED: Homo sapiens F-box and leucine rich repeat protein 3 (FBXL3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXL3 (26224)
Length:
3162
CDS:
447..1277

Additional Resources:

NCBI RefSeq record:
XM_005266337.3
NBCI Gene record:
FBXL3 (26224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004281 CGGATGTGAAATAACCAGTTA pLKO.1 1511 3UTR 100% 4.950 6.930 N FBXL3 n/a
2 TRCN0000004283 CGATTAGAACATTTGCGCATT pLKO.1 741 CDS 100% 4.050 5.670 N FBXL3 n/a
3 TRCN0000364484 CCTATCTCAATTATCCATTAT pLKO_005 1148 CDS 100% 13.200 10.560 N FBXL3 n/a
4 TRCN0000369033 AGCAGTCATATCTCCGAATTT pLKO_005 1476 3UTR 100% 13.200 9.240 N FBXL3 n/a
5 TRCN0000364482 ATATCCAAGAAGTACTAATAG pLKO_005 1582 3UTR 100% 13.200 9.240 N FBXL3 n/a
6 TRCN0000369031 CTGATCAGTGTCACGGCTTAA pLKO_005 649 CDS 100% 10.800 7.560 N FBXL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02932 pDONR223 100% 64.4% 64.4% None 0_1ins456 n/a
2 ccsbBroad304_02932 pLX_304 0% 64.4% 64.4% V5 0_1ins456 n/a
3 TRCN0000481056 ACTCTGTGCATTCTGCAGGATTAC pLX_317 11.9% 64.4% 64.4% V5 0_1ins456 n/a
Download CSV