Transcript: Mouse XM_006519243.3

PREDICTED: Mus musculus F-box and leucine-rich repeat protein 3 (Fbxl3), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxl3 (50789)
Length:
2858
CDS:
191..1021

Additional Resources:

NCBI RefSeq record:
XM_006519243.3
NBCI Gene record:
Fbxl3 (50789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519243.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126944 GCCTTGTGTAACTCTAGGTTT pLKO.1 1663 3UTR 100% 4.950 3.465 N Fbxl3 n/a
2 TRCN0000126945 GCCCTGAACTACCATTTGCTA pLKO.1 422 CDS 100% 3.000 2.100 N Fbxl3 n/a
3 TRCN0000126948 GCCTCTTGATGAAGAGTTAAT pLKO.1 769 CDS 100% 1.320 0.924 N Fbxl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519243.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02932 pDONR223 100% 58.1% 64.2% None (many diffs) n/a
2 ccsbBroad304_02932 pLX_304 0% 58.1% 64.2% V5 (many diffs) n/a
3 TRCN0000481056 ACTCTGTGCATTCTGCAGGATTAC pLX_317 11.9% 58.1% 64.2% V5 (many diffs) n/a
Download CSV