Construct: ORF TRCN0000481080
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010985.1_s317c1
- Derived from:
- ccsbBroadEn_11757
- DNA Barcode:
- CCAATCATGGCTCGCCACAAAACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CADM1 (23705)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481080
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23705 | CADM1 | cell adhesion molecule 1 | NM_001098517.2 | 90.5% | 90.8% | (many diffs) |
2 | human | 23705 | CADM1 | cell adhesion molecule 1 | XM_005271494.3 | 88.2% | 88.4% | (many diffs) |
3 | human | 23705 | CADM1 | cell adhesion molecule 1 | NM_014333.4 | 84.8% | 85% | (many diffs) |
4 | human | 23705 | CADM1 | cell adhesion molecule 1 | NM_001301045.2 | 84.7% | 84.8% | (many diffs) |
5 | human | 23705 | CADM1 | cell adhesion molecule 1 | NM_001301044.2 | 82.8% | 83% | (many diffs) |
6 | human | 23705 | CADM1 | cell adhesion molecule 1 | NM_001301043.2 | 79.7% | 79.8% | (many diffs) |
7 | human | 23705 | CADM1 | cell adhesion molecule 1 | XM_017017457.2 | 71.1% | 69.8% | (many diffs) |
8 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | NM_001025600.1 | 82.5% | 88.7% | (many diffs) |
9 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | NM_207676.2 | 80.4% | 86.4% | (many diffs) |
10 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | NM_018770.3 | 77.3% | 83.1% | (many diffs) |
11 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | XM_006510497.3 | 77.2% | 82.9% | (many diffs) |
12 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | NM_207675.2 | 75.5% | 81.1% | (many diffs) |
13 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | NM_001310841.1 | 72.7% | 78% | (many diffs) |
14 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | XM_017313489.1 | 46.7% | 49.6% | (many diffs) |
15 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | XM_017313487.1 | 45% | 47.7% | (many diffs) |
16 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | XM_017313488.1 | 45% | 47.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1227
- ORF length:
- 1161
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gagtgtagtg ctgccgagcg gatcccagtg tgcggcggca gcggcggcgg 121 cggcgcctcc cgggctccgg ctccggcttc tgctgttgct cttctccgcc gcggcactga 181 tccccacagg tgatgggcag aatctgttta cgaaagacgt gacagtgatc gagggagagg 241 ttgcgaccat cagttgccaa gtcaataaga gtgacgactc tgtgattcag ctactgaatc 301 ccaacaggca gaccatttat ttcagggact tcaggccttt gaaggacagc aggtttcagt 361 tgctgaattt ttctagcagt gaactcaaag tatcattgac aaacgtctca atttctgatg 421 aaggaagata cttttgccag ctctataccg atcccccaca ggaaagttac accaccatca 481 cagtcctggt cccaccacgt aatctgatga tcgatatcca gaaagacact gcggtggaag 541 gtgaggagat tgaagtcaac tgcactgcta tggccagcaa gccagccacg actatcaggt 601 ggttcaaagg gaacacagag ctaaaaggca aatcggaggt ggaagagtgg tcagacatgt 661 acactgtgac cagtcagctg atgctgaagg tgcacaagga ggacgatggg gtcccagtga 721 tctgccaggt ggagcaccct gcggtcactg gaaacctgca gacccagcgg tatctagaag 781 tacagtataa gccTCAAGTG CACATTCAGA TGACTTATCC TCTACAAGGC TTAACCCGGG 841 AAGGGGACGC GCTTGAGTTA ACATGTGAAG CCATCGGGAA GCCCCAGCCT GTGATGGTAA 901 CTTGGGTGAG AGTCGATGAT GAAATGCCTC AACACGCCGT ACTGTCTGGG CCCAACCTGT 961 TCATCAATAA CCTAAACAAA ACAGATAATG GTACATACCG CTGTGAAGCT TCAAACATAG 1021 TGGGGAAAGC TCACTCGGAT TATATGCTGT ATGTATACGA TTCCCGAGCA GGTGAAGAAG 1081 GCTCGATCAG GGCAGTGGAT CATGCCGTGA TCGGTGGCGT CGTGGCGGTG GTGGTGTTCG 1141 CCATGCTGTG CTTGCTCATC ATTCTGGGGC GCTATTTTGC CAGACATAAA GGCCTGTTTT 1201 CTCTAACCTC CTCTCCCAGA ATAAAGTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1261 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1321 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACCAATCAT 1381 GGCTCGCCAC AAAACTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1441 aagatt