Construct: ORF TRCN0000481251
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007473.1_s317c1
- Derived from:
- ccsbBroadEn_10401
- DNA Barcode:
- CGGCAAGATACATCCAGTGTCTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CEP170P1 (645455)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481251
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 645455 | CEP170P1 | centrosomal protein 170 pse... | NR_003135.3 | 81% | 1_99del;979_1085del | |
| 2 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002951.2 | 21.7% | 21.6% | (many diffs) |
| 3 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002950.2 | 20.6% | 20.5% | (many diffs) |
| 4 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002949.2 | 20.2% | 20.1% | (many diffs) |
| 5 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002946.2 | 20.2% | 20.1% | (many diffs) |
| 6 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002947.2 | 20% | 19.9% | (many diffs) |
| 7 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002948.2 | 20% | 19.9% | (many diffs) |
| 8 | human | 9859 | CEP170 | centrosomal protein 170 | NM_001042405.1 | 19.9% | 19.7% | (many diffs) |
| 9 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002945.2 | 19.7% | 19.6% | (many diffs) |
| 10 | human | 9859 | CEP170 | centrosomal protein 170 | NM_001042404.1 | 19.5% | 19.4% | (many diffs) |
| 11 | human | 9859 | CEP170 | centrosomal protein 170 | XM_011544344.3 | 19.4% | 19.3% | (many diffs) |
| 12 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002944.2 | 19.4% | 19.3% | (many diffs) |
| 13 | human | 9859 | CEP170 | centrosomal protein 170 | XM_011544343.3 | 19.4% | 19.3% | (many diffs) |
| 14 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002942.2 | 18.9% | 18.8% | (many diffs) |
| 15 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002943.2 | 18.9% | 18.8% | (many diffs) |
| 16 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002938.2 | 18.7% | 18.6% | (many diffs) |
| 17 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002937.2 | 18.6% | 18.5% | (many diffs) |
| 18 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002941.2 | 18.6% | 18.5% | (many diffs) |
| 19 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002935.2 | 18.5% | 18.4% | (many diffs) |
| 20 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002939.2 | 18.5% | 18.4% | (many diffs) |
| 21 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002940.2 | 18.5% | 18.4% | (many diffs) |
| 22 | human | 9859 | CEP170 | centrosomal protein 170 | NM_014812.3 | 18.3% | 18.2% | (many diffs) |
| 23 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002936.2 | 18.3% | 18.2% | (many diffs) |
| 24 | human | 9859 | CEP170 | centrosomal protein 170 | XM_011544342.3 | 18.2% | 18.1% | (many diffs) |
| 25 | human | 9859 | CEP170 | centrosomal protein 170 | XM_011544341.3 | 18.2% | 18.1% | (many diffs) |
| 26 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002933.2 | 18.2% | 18.1% | (many diffs) |
| 27 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002934.2 | 18.2% | 18.1% | (many diffs) |
| 28 | human | 9859 | CEP170 | centrosomal protein 170 | XM_011544340.3 | 18% | 17.9% | (many diffs) |
| 29 | human | 9859 | CEP170 | centrosomal protein 170 | XM_011544339.3 | 17.9% | 17.8% | (many diffs) |
| 30 | human | 9859 | CEP170 | centrosomal protein 170 | XM_011544338.3 | 17.8% | 17.7% | (many diffs) |
| 31 | human | 9859 | CEP170 | centrosomal protein 170 | XM_011544337.3 | 17.6% | 17.5% | (many diffs) |
| 32 | human | 9859 | CEP170 | centrosomal protein 170 | XM_006711843.4 | 17.5% | 17.4% | (many diffs) |
| 33 | human | 9859 | CEP170 | centrosomal protein 170 | XM_011544334.3 | 17.5% | 17.4% | (many diffs) |
| 34 | human | 9859 | CEP170 | centrosomal protein 170 | XM_011544335.3 | 17.5% | 17.4% | (many diffs) |
| 35 | human | 9859 | CEP170 | centrosomal protein 170 | XM_011544336.2 | 17.5% | 17.4% | (many diffs) |
| 36 | human | 9859 | CEP170 | centrosomal protein 170 | XM_017002932.1 | 17.5% | 17.4% | (many diffs) |
| 37 | mouse | 545389 | Cep170 | centrosomal protein 170 | NM_001368872.1 | 18.5% | 19.1% | (many diffs) |
| 38 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_017321736.2 | 18.3% | 18.9% | (many diffs) |
| 39 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_006496948.4 | 18.1% | 18.8% | (many diffs) |
| 40 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_006496947.4 | 18% | 18.6% | (many diffs) |
| 41 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_006496945.4 | 17.7% | 18.3% | (many diffs) |
| 42 | mouse | 545389 | Cep170 | centrosomal protein 170 | NM_001368873.1 | 17.5% | 18.1% | (many diffs) |
| 43 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_006496944.4 | 17.5% | 18.1% | (many diffs) |
| 44 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_030255572.1 | 17.1% | 17.7% | (many diffs) |
| 45 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_006496943.4 | 17% | 17.6% | (many diffs) |
| 46 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_030255571.1 | 16.9% | 17.5% | (many diffs) |
| 47 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_030255570.1 | 16.8% | 17.4% | (many diffs) |
| 48 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_030255569.1 | 16.7% | 17.3% | (many diffs) |
| 49 | mouse | 545389 | Cep170 | centrosomal protein 170 | NM_001099637.2 | 16.6% | 17.1% | (many diffs) |
| 50 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_006496939.4 | 16.6% | 17.1% | (many diffs) |
| 51 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_006496940.4 | 16.6% | 17.1% | (many diffs) |
| 52 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_006496937.4 | 16.4% | 17% | (many diffs) |
| 53 | mouse | 545389 | Cep170 | centrosomal protein 170 | XM_030255566.1 | 16.4% | 17% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 945
- ORF length:
- 879
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc tactagttct tcattcaaac accggattaa agagcaggaa gactacatcc 121 gagattggac tgctcatcga gaagagatag ccaggatcag ccaagatctt gctctcattg 181 ctcgggagat caacgatgta gcaggagaga tagattcagt gacttcatca ggcactgccc 241 ctagtaccac attggttgat cgtgtttttg atgaaagcct caacttccaa aagattcctc 301 cattagttca ttccaaaaca ccagaaggaa acaacggtcg atctggtgat ccaagacctc 361 aagcagcaga gcctcccgat cacttaacaa ttacaaggcg gagaacctgg agcagggatg 421 aagtcatggg agataatctg ctgctgtcat ccgtctttca gttctctaag aagataagac 481 aatCTATAGA TAAGACAGCT GGAAAGATCA GAATATTATT TAAAGACAAA GATCGGAATT 541 GGGATGACAT AGAAAGCAAA TTAAGAGCCG AAAGTGAAGT CCCTATTGTG AAAACCTCGA 601 GCATGGAGAT TTCTTCTATC TTACAGGAAC TGAAAAGAGT AGAAAAGCAG CTACAAGCAA 661 TCAATGCTAT GATTGATCCT GATGGAACTT TGGAGGCTCT GAACAACATG GGATTTCCCA 721 GTGCTATGTT GCCATCTCCA CCGAAACAGA AGTCCAGCCC TGTGAATAAC CACCACAGCC 781 CGGGTCAGAC ACCAACACTT GGCCAACCAG AAGCTAGGGC TCTTCATCCT GCTGCTGTTT 841 CAGCCGCAGC TGAATTTGAG AATGCTGAAT CTGAGGCTGA TTTCAGTATA CATTTCAATA 901 GAGTCAACCC TGATGGGGAA GAGGAAGATG TTACAGTACA TAAATGCCCA ACTTTCTTGT 961 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1021 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1081 GAAAGGACGA CGGCAAGATA CATCCAGTGT CTTCACGCGT TAAGTCgaca atcaacctct 1141 ggattacaaa atttgtgaaa gatt