Transcript: Mouse XM_006496939.4

PREDICTED: Mus musculus centrosomal protein 170 (Cep170), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cep170 (545389)
Length:
6888
CDS:
125..4861

Additional Resources:

NCBI RefSeq record:
XM_006496939.4
NBCI Gene record:
Cep170 (545389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496939.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243676 ATAGTTTAGGTGGAGTATATT pLKO_005 5734 3UTR 100% 15.000 21.000 N Cep170 n/a
2 TRCN0000243677 GATTAGACAATCCATTGATAA pLKO_005 4375 CDS 100% 13.200 18.480 N Cep170 n/a
3 TRCN0000243678 TTCATTCAAGCACCGAATTAA pLKO_005 3931 CDS 100% 15.000 12.000 N Cep170 n/a
4 TRCN0000243679 CCGAGCATCCTGATCACTTAA pLKO_005 4269 CDS 100% 13.200 9.240 N Cep170 n/a
5 TRCN0000145016 GATGAAGTCATGGGAGATAAT pLKO.1 4319 CDS 100% 13.200 9.240 N CEP170P1 n/a
6 TRCN0000243675 GGCGCTTTCCTACTGATTATG pLKO_005 3786 CDS 100% 13.200 9.240 N Cep170 n/a
7 TRCN0000296286 GGCGCTTTCCTACTGATTATG pLKO_005 3786 CDS 100% 13.200 9.240 N CEP170 n/a
8 TRCN0000123335 CCTCAGAAGATGAATTTGGAT pLKO.1 3813 CDS 100% 3.000 2.100 N CEP170 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496939.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10401 pDONR223 100% 16.6% 17.1% None (many diffs) n/a
2 ccsbBroad304_10401 pLX_304 0% 16.6% 17.1% V5 (many diffs) n/a
3 TRCN0000481251 CGGCAAGATACATCCAGTGTCTTC pLX_317 52.5% 16.6% 17.1% V5 (many diffs) n/a
Download CSV