Transcript: Human XM_011544344.3

PREDICTED: Homo sapiens centrosomal protein 170 (CEP170), transcript variant X25, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP170 (9859)
Length:
6745
CDS:
234..4724

Additional Resources:

NCBI RefSeq record:
XM_011544344.3
NBCI Gene record:
CEP170 (9859)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544344.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296294 ACCAGATACTCCCAGTTATAA pLKO_005 2690 CDS 100% 15.000 10.500 N CEP170 n/a
2 TRCN0000296296 AGTTTCACTAGCCTCTATAAA pLKO_005 2811 CDS 100% 15.000 10.500 N CEP170 n/a
3 TRCN0000243676 ATAGTTTAGGTGGAGTATATT pLKO_005 5582 3UTR 100% 15.000 10.500 N Cep170 n/a
4 TRCN0000243675 GGCGCTTTCCTACTGATTATG pLKO_005 3631 CDS 100% 13.200 9.240 N Cep170 n/a
5 TRCN0000296286 GGCGCTTTCCTACTGATTATG pLKO_005 3631 CDS 100% 13.200 9.240 N CEP170 n/a
6 TRCN0000296262 TGACGTATAATGTAGTATATC pLKO_005 4869 3UTR 100% 13.200 9.240 N CEP170 n/a
7 TRCN0000123336 GCAGTCTCGTAGTGTGGATAA pLKO.1 335 CDS 100% 10.800 7.560 N CEP170 n/a
8 TRCN0000123334 GCAAACTAAATAGCCAACATT pLKO.1 5057 3UTR 100% 5.625 3.938 N CEP170 n/a
9 TRCN0000123338 GCTCTGCTTCAGTAAATTCAA pLKO.1 3604 CDS 100% 5.625 3.938 N CEP170 n/a
10 TRCN0000289577 GCTCTGCTTCAGTAAATTCAA pLKO_005 3604 CDS 100% 5.625 3.938 N CEP170 n/a
11 TRCN0000123335 CCTCAGAAGATGAATTTGGAT pLKO.1 3658 CDS 100% 3.000 2.100 N CEP170 n/a
12 TRCN0000145016 GATGAAGTCATGGGAGATAAT pLKO.1 4194 CDS 100% 13.200 6.600 Y CEP170P1 n/a
13 TRCN0000142152 GCCGAAAGTGAAGTCCCTATT pLKO.1 4344 CDS 100% 10.800 5.400 Y CEP170P1 n/a
14 TRCN0000143509 GCTCTGAACAACATGGGATTT pLKO.1 4473 CDS 100% 10.800 5.400 Y CEP170P1 n/a
15 TRCN0000145071 CGTCTTTCAGTTCTCTAAGAA pLKO.1 4229 CDS 100% 5.625 2.813 Y CEP170P1 n/a
16 TRCN0000141633 CTCTTCATCCTGCTGCTGTTT pLKO.1 4597 CDS 100% 4.950 2.475 Y CEP170P1 n/a
17 TRCN0000144760 GAAGAGGAAGATGTTACAGTA pLKO.1 4695 CDS 100% 4.950 2.475 Y CEP170P1 n/a
18 TRCN0000144672 GAGAGATAGATTCAGTGACTT pLKO.1 3901 CDS 100% 4.950 2.475 Y CEP170P1 n/a
19 TRCN0000143391 GATCGGAATTGGGATGACATA pLKO.1 4308 CDS 100% 4.950 2.475 Y CEP170P1 n/a
20 TRCN0000142039 GCCGCAGCTGAATTTGAGAAT pLKO.1 4620 CDS 100% 4.950 2.475 Y CEP170P1 n/a
21 TRCN0000141173 CAGGAAGACTACATCCGAGAT pLKO.1 3801 CDS 100% 4.050 2.025 Y CEP170P1 n/a
22 TRCN0000123337 GCTGAATTTGAGAATGCTGAA pLKO.1 4626 CDS 100% 4.050 2.025 Y CEP170 n/a
23 TRCN0000144893 GCTGAATTTGAGAATGCTGAA pLKO.1 4626 CDS 100% 4.050 2.025 Y CEP170P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544344.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10401 pDONR223 100% 19.4% 19.3% None (many diffs) n/a
2 ccsbBroad304_10401 pLX_304 0% 19.4% 19.3% V5 (many diffs) n/a
3 TRCN0000481251 CGGCAAGATACATCCAGTGTCTTC pLX_317 52.5% 19.4% 19.3% V5 (many diffs) n/a
Download CSV