Transcript: Human NM_001139441.1

Homo sapiens B cell receptor associated protein 31 (BCAP31), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
BCAP31 (10134)
Length:
1346
CDS:
157..897

Additional Resources:

NCBI RefSeq record:
NM_001139441.1
NBCI Gene record:
BCAP31 (10134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001139441.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242711 ATCGATGCCGTGCGCGAAATT pLKO_005 346 CDS 100% 13.200 18.480 N BCAP31 n/a
2 TRCN0000012419 GCCTCCAATGAAGCCTTTAAA pLKO.1 547 CDS 100% 15.000 10.500 N Bcap31 n/a
3 TRCN0000278073 GCCTCCAATGAAGCCTTTAAA pLKO_005 547 CDS 100% 15.000 10.500 N Bcap31 n/a
4 TRCN0000242710 GACGCCTGGTGACTCTCATTT pLKO_005 506 CDS 100% 13.200 9.240 N BCAP31 n/a
5 TRCN0000242709 CCTATGGCAACACCTTCTTTG pLKO_005 293 CDS 100% 10.800 7.560 N BCAP31 n/a
6 TRCN0000242708 TCCTCTATGCGGAGGTCTTTG pLKO_005 188 CDS 100% 10.800 7.560 N BCAP31 n/a
7 TRCN0000242712 TACACGTTCAGAATGCGTTTG pLKO_005 1089 3UTR 100% 6.000 4.200 N BCAP31 n/a
8 TRCN0000179092 CATGGACAAGAAGGAAGAGTA pLKO.1 876 CDS 100% 4.950 3.465 N BCAP31 n/a
9 TRCN0000179186 GAATCTCTACATTGCTGGCTT pLKO.1 459 CDS 100% 2.640 1.848 N BCAP31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001139441.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02326 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02326 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481258 GAGCAGAGCGCCCAGACGTTGTCA pLX_317 51.9% 100% 100% V5 n/a
4 ccsbBroadEn_15694 pDONR223 0% 99.8% 99.5% None 214A>G n/a
5 ccsbBroad304_15694 pLX_304 0% 99.8% 99.5% V5 214A>G n/a
6 TRCN0000474561 AACAGTTCAGGTCACCGGCGTCGC pLX_317 64.2% 99.8% 99.5% V5 214A>G n/a
Download CSV