Construct: ORF TRCN0000481275
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013008.1_s317c1
- Derived from:
- ccsbBroadEn_07819
- DNA Barcode:
- CACGATTTGCCCATCTTACTAAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SEPHS1 (22929)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481275
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 22929 | SEPHS1 | selenophosphate synthetase 1 | NM_012247.5 | 99.9% | 100% | 471A>G |
2 | human | 22929 | SEPHS1 | selenophosphate synthetase 1 | XM_017015943.2 | 99.9% | 100% | 471A>G |
3 | human | 22929 | SEPHS1 | selenophosphate synthetase 1 | XM_017015944.2 | 99.4% | 99.4% | 471A>G;748_749insCAGCTG |
4 | human | 22929 | SEPHS1 | selenophosphate synthetase 1 | NM_001195602.1 | 82.8% | 82.9% | 0_1ins201;270A>G |
5 | human | 22929 | SEPHS1 | selenophosphate synthetase 1 | XM_017015945.2 | 82.8% | 82.9% | 0_1ins201;270A>G |
6 | human | 22929 | SEPHS1 | selenophosphate synthetase 1 | NM_001195604.2 | 81.8% | 81.8% | 471A>G;748_749ins213 |
7 | mouse | 109079 | Sephs1 | selenophosphate synthetase 1 | NM_175400.6 | 89.7% | 99.4% | (many diffs) |
8 | mouse | 109079 | Sephs1 | selenophosphate synthetase 1 | XM_006497309.2 | 89.7% | 99.4% | (many diffs) |
9 | mouse | 109079 | Sephs1 | selenophosphate synthetase 1 | XM_017314904.1 | 89.7% | 99.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1242
- ORF length:
- 1176
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tacgcgggag tcctttaacc cggaaagtta cgaattggac aaaagcttcc 121 ggctaaccag attcactgaa ctgaagggca caggctgcaa agtgccccaa gatgtcctgc 181 aaaaattgct ggaatcttta caggagaacc acttccaaga agatgagcag tttctgggag 241 ccgttatgcc aaggcttggc attggaatgg atacttgtgt cattcctttg aggcacggtg 301 ggctttcctt ggttcaaacc acagattaca tttacccgat cgtagacgac ccttacatga 361 tgggcaggat agcgtgtgcc aatgtcctca gtgacctcta tgcaatgggg gtcacggaat 421 gtgacaatat gctgatgctc cttggagtca gtaataaaat gaccgacagg gaaagggata 481 aagtgatgcc tctgattatc caaggtttta aagacgcagc tgaggaagca ggaacgtctg 541 taacaggcgg ccaaacagta ctaaacccct ggattgtcct gggaggagtg gctaccactg 601 tctgccaacc caatgaattt atcatgccag acaatgcagt gccaggggac gtgctggtgc 661 tgacaaaacc cctggggaca caggtggcag tggctgtgca ccagtggctg gatatccctg 721 agaaatggaa taagattaaa ctagtggtca cccaagaaga tgtagagctg gcctaccagg 781 aggcgatgat gaacatggcg aggctcaaca ggacagctgc aggactcatg cacacgttca 841 atgcccacgc cgccactgac atcacgggcT TCGGGATTTT GGGCCATGCG CAGAACCTGG 901 CCAAGCAGCA GAGGAACGAG GTGTCGTTTG TAATTCACAA CCTCCCGGTG CTGGCCAAGA 961 TGGCTGCGGT GAGCAAGGCC TGCGGAAACA TGTTCGGCCT CATGCACGGG ACCTGCCCGG 1021 AGACTTCAGG CGGCCTTCTG ATCTGTTTAC CACGTGAGCA AGCAGCTCGG TTCTGTGCAG 1081 AGATAAAGTC CCCCAAATAT GGTGAAGGCC ACCAAGCATG GATTATTGGG ATTGTAGAGA 1141 AGGGCAACCG CACAGCCAGA ATCATAGACA AACCCCGGAT CATCGAGGTC GCACCACAAG 1201 TGGCCACTCA AAATGTGAAT CCCACACCCG GGGCCACCTC TTACCCAACT TTCTTGTACA 1261 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1321 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1381 AGGACGACAC GATTTGCCCA TCTTACTAAA AACGCGTTAA GTCgacaatc aacctctgga 1441 ttacaaaatt tgtgaaagat t