Transcript: Human NM_001195602.1

Homo sapiens selenophosphate synthetase 1 (SEPHS1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
SEPHS1 (22929)
Length:
3004
CDS:
308..1285

Additional Resources:

NCBI RefSeq record:
NM_001195602.1
NBCI Gene record:
SEPHS1 (22929)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001195602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045880 GCATGGATTATTGGGATTGTA pLKO.1 1157 CDS 100% 5.625 7.875 N SEPHS1 n/a
2 TRCN0000290118 GCATGGATTATTGGGATTGTA pLKO_005 1157 CDS 100% 5.625 7.875 N SEPHS1 n/a
3 TRCN0000045878 CCTTCCTGATATTTACAGTAA pLKO.1 1928 3UTR 100% 4.950 6.930 N SEPHS1 n/a
4 TRCN0000290185 CCTTCCTGATATTTACAGTAA pLKO_005 1928 3UTR 100% 4.950 6.930 N SEPHS1 n/a
5 TRCN0000045879 GCCTCTGATTATCCAAGGTTT pLKO.1 529 CDS 100% 4.950 6.930 N SEPHS1 n/a
6 TRCN0000290187 GCCTCTGATTATCCAAGGTTT pLKO_005 529 CDS 100% 4.950 6.930 N SEPHS1 n/a
7 TRCN0000082441 CCTTGGTTCAAACCACAGATT pLKO.1 348 CDS 100% 4.950 3.960 N SEPHS1P4 n/a
8 TRCN0000082421 ACAGCCAGAATCATAGACAAA pLKO.1 1193 CDS 100% 4.950 3.465 N LOC389069 n/a
9 TRCN0000082418 CCTGTTACATTAACTGAAGAT pLKO.1 1456 3UTR 100% 4.950 3.465 N LOC389069 n/a
10 TRCN0000045881 CCTTACATGATGGGCAGGATA pLKO.1 392 CDS 100% 4.950 3.465 N SEPHS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02704 pDONR223 100% 82.9% 82.9% None 0_1ins201 n/a
2 ccsbBroad304_02704 pLX_304 0% 82.9% 82.9% V5 0_1ins201 n/a
3 ccsbBroadEn_07819 pDONR223 100% 82.8% 82.9% None 0_1ins201;270A>G n/a
4 ccsbBroad304_07819 pLX_304 0% 82.8% 82.9% V5 0_1ins201;270A>G n/a
5 TRCN0000481275 CACGATTTGCCCATCTTACTAAAA pLX_317 32% 82.8% 82.9% V5 0_1ins201;270A>G n/a
Download CSV