Transcript: Mouse NM_175400.6

Mus musculus selenophosphate synthetase 1 (Sephs1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Sephs1 (109079)
Length:
5329
CDS:
379..1557

Additional Resources:

NCBI RefSeq record:
NM_175400.6
NBCI Gene record:
Sephs1 (109079)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175400.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075770 CGGAAACATGTTCGGCCTAAT pLKO.1 1296 CDS 100% 10.800 15.120 N Sephs1 n/a
2 TRCN0000075771 CCAGCCCAATGAATTTATCAT pLKO.1 918 CDS 100% 5.625 7.875 N Sephs1 n/a
3 TRCN0000075769 CCGTATATGATGGGCAGGATA pLKO.1 664 CDS 100% 4.950 6.930 N Sephs1 n/a
4 TRCN0000075772 GCCAGCCCAATGAATTTATCA pLKO.1 917 CDS 100% 5.625 4.500 N Sephs1 n/a
5 TRCN0000082418 CCTGTTACATTAACTGAAGAT pLKO.1 1727 3UTR 100% 4.950 3.960 N LOC389069 n/a
6 TRCN0000075768 CCACCATTGTATTTCAGGAAT pLKO.1 5148 3UTR 100% 4.950 3.465 N Sephs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175400.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02704 pDONR223 100% 89.7% 99.4% None (many diffs) n/a
2 ccsbBroad304_02704 pLX_304 0% 89.7% 99.4% V5 (many diffs) n/a
3 ccsbBroadEn_07819 pDONR223 100% 89.7% 99.4% None (many diffs) n/a
4 ccsbBroad304_07819 pLX_304 0% 89.7% 99.4% V5 (many diffs) n/a
5 TRCN0000481275 CACGATTTGCCCATCTTACTAAAA pLX_317 32% 89.7% 99.4% V5 (many diffs) n/a
Download CSV