Construct: ORF TRCN0000481278
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011433.1_s317c1
- Derived from:
- ccsbBroadEn_11658
- DNA Barcode:
- ATGTTAGGGCATGGGCCGAAACAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WDFY3 (23001)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481278
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_017007909.1 | 14.6% | 14.6% | 1_7338del |
2 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531765.3 | 11.9% | 11.9% | 1_9267del |
3 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531764.3 | 11.9% | 11.9% | 1_9288del |
4 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | NM_014991.5 | 11.9% | 11.9% | 1_9318del |
5 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531763.3 | 11.9% | 11.9% | 1_9318del |
6 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531762.3 | 11.9% | 11.9% | 1_9321del |
7 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531761.3 | 11.9% | 11.9% | 1_9327del |
8 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_005262858.5 | 11.8% | 11.8% | 1_9372del |
9 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531757.3 | 11.8% | 11.8% | 1_9372del |
10 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531759.2 | 11.8% | 11.8% | 1_9372del |
11 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531760.3 | 11.8% | 11.8% | 1_9372del |
12 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_017007906.2 | 11.8% | 11.8% | 1_9372del |
13 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_017007907.2 | 11.8% | 11.8% | 1_9372del |
14 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_017007908.2 | 11.8% | 11.8% | 1_9372del |
15 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535227.3 | 10.4% | 11.4% | (many diffs) |
16 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | NM_172882.3 | 10.4% | 11.3% | (many diffs) |
17 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535226.3 | 10.4% | 11.3% | (many diffs) |
18 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535225.3 | 10.4% | 11.3% | (many diffs) |
19 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535224.3 | 10.4% | 11.3% | (many diffs) |
20 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535220.3 | 10.4% | 11.3% | (many diffs) |
21 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535221.2 | 10.4% | 11.3% | (many diffs) |
22 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535222.3 | 10.4% | 11.3% | (many diffs) |
23 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535223.3 | 10.4% | 11.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1326
- ORF length:
- 1260
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg cacctccaaa gaaaaggcca agaccgtcac cctcaaacag gccttactgg 121 gccacactga taccgtcacc tgcgccacag catcattagc ctatcacata attgtcagtg 181 ggtcccgtga tcgaacctgt atcatttggg atttgaacaa actgtcattt ctaacccagc 241 ttcgagggca tcgagctcca gtttctgctc tttgtatcaa tgaattaaca ggggacattg 301 tgtcctgcgc tggcacatat atccatgtgt ggagcatcaa tgggaaccct atcgtgagtg 361 tcaacacgtt cacaggtagg agccagcaga tcatctgctg ctgcatgtcg gagatgaacg 421 aatgggacac gcagaacgtc atagtgacag gacactcaga tggagtggtt cggttttgga 481 gaatggaatt tttgcaagtt cctgaaacac cagctcctga gcctgctgaa gtcctagaaa 541 tgcaggaaga ctgtccagaa gcacaaatag ggcaggaagc ccaagacgag gacagcagtg 601 attcagaagc agatgagcag agcatcagcc aggaccctaa ggacactcca agccaaccca 661 gcagcaccag ccacaggccc cgggcagcct cctgccgcgc aacagccgcc tggtgtactg 721 acagtggctc tgacgactcc agacgctggt ccgaccagct cagtctagat gagaaagacg 781 gcttcatatt tgtgaactat tcagagggcc agaccagagc ccatctgcag ggccccctta 841 gccaccccca ccccaaTCCC ATTGAGGTGC GGAATTACAG CAGATTGAAA CCTGGGTACC 901 GATGGGAACG GCAGCTGGTG TTCAGGAGTA AGCTGACTAT GCACACAGCC TTTGATCGAA 961 AGGACAATGC ACACCCAGCT GAGGTCACTG CCTTGGGCAT CTCCAAGGAT CACAGTAGGA 1021 TCCTCGTTGG TGACAGTCGA GGCCGAGTTT TCAGCTGGTC TGTGAGTGAC CAGCCAGGCC 1081 GTTCTGCTGC TGATCACTGG GTGAAGGATG AAGGTGGTGA CAGCTGCTCA GGCTGCTCGG 1141 TGAGGTTTTC ACTCACAGAA AGACGACACC ATTGCAGGAA CTGTGGTCAG CTCTTCTGCC 1201 AGAAGTGCAG TCGCTTTCAA TCTGAAATCA AACGCTTGAA AATCTCATCC CCGGTGCGTG 1261 TTTGTCAGAA CTGTTATTAT AACTTACAGC ATGAGAGAGG TTCAGAAGAT GGGCCTCGAA 1321 ATTGTTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1381 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1441 CTTGGCTTTA TATATCTTGT GGAAAGGACG AATGTTAGGG CATGGGCCGA AACAAACGCG 1501 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt