Transcript: Mouse XM_006535226.3

PREDICTED: Mus musculus WD repeat and FYVE domain containing 3 (Wdfy3), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdfy3 (72145)
Length:
14498
CDS:
764..11293

Additional Resources:

NCBI RefSeq record:
XM_006535226.3
NBCI Gene record:
Wdfy3 (72145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311327 TATGGCCGACAACGCTAATTA pLKO_005 1996 CDS 100% 15.000 21.000 N Wdfy3 n/a
2 TRCN0000111646 GCGCCCACAATATAGTGAAAT pLKO.1 2487 CDS 100% 13.200 18.480 N Wdfy3 n/a
3 TRCN0000111648 GCGCAGTTACAGCAGATTGAA pLKO.1 10834 CDS 100% 5.625 7.875 N Wdfy3 n/a
4 TRCN0000351338 GCGCAGTTACAGCAGATTGAA pLKO_005 10834 CDS 100% 5.625 7.875 N Wdfy3 n/a
5 TRCN0000111649 CGCCACTACTTTACAGTACAT pLKO.1 4966 CDS 100% 4.950 3.960 N Wdfy3 n/a
6 TRCN0000305435 CTCGCTCACTGCCTGATTAAT pLKO_005 7193 CDS 100% 15.000 10.500 N Wdfy3 n/a
7 TRCN0000305491 TAGAGCTATTCATCCTTATTT pLKO_005 11592 3UTR 100% 15.000 10.500 N Wdfy3 n/a
8 TRCN0000305492 TTCTAGCGTGACTACTATTTA pLKO_005 4594 CDS 100% 15.000 10.500 N Wdfy3 n/a
9 TRCN0000111647 GCCAAGTTGATGAGGGAATTT pLKO.1 5372 CDS 100% 13.200 9.240 N Wdfy3 n/a
10 TRCN0000111645 GCTGAGTGTAAAGGAATCATT pLKO.1 11407 3UTR 100% 5.625 3.938 N Wdfy3 n/a
11 TRCN0000240702 CGGATATGGCAAGGATATAAT pLKO_005 1676 CDS 100% 15.000 21.000 N WDFY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11658 pDONR223 100% 10.4% 11.3% None (many diffs) n/a
2 ccsbBroad304_11658 pLX_304 0% 10.4% 11.3% V5 (many diffs) n/a
3 TRCN0000481278 ATGTTAGGGCATGGGCCGAAACAA pLX_317 37.5% 10.4% 11.3% V5 (many diffs) n/a
4 ccsbBroadEn_15746 pDONR223 0% 6.9% 7.4% None (many diffs) n/a
5 ccsbBroad304_15746 pLX_304 0% 6.9% 7.4% V5 (many diffs) n/a
6 TRCN0000481357 CCGACATATTCGCACACAATTTTG pLX_317 47.9% 6.9% 7.4% V5 (many diffs) n/a
Download CSV