Construct: ORF TRCN0000481283
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008625.2_s317c1
- Derived from:
- ccsbBroadEn_03899
- DNA Barcode:
- GGAACTAAGGTCCTCACAGTTAAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- ZFAND3 (60685)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481283
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 60685 | ZFAND3 | zinc finger AN1-type contai... | NM_021943.3 | 100% | 100% | |
| 2 | human | 60685 | ZFAND3 | zinc finger AN1-type contai... | XM_005249269.2 | 90.3% | 89.8% | 295_296ins66 |
| 3 | human | 60685 | ZFAND3 | zinc finger AN1-type contai... | XM_017011171.2 | 86.6% | 84.9% | (many diffs) |
| 4 | human | 60685 | ZFAND3 | zinc finger AN1-type contai... | XM_011514790.2 | 75.3% | 75.3% | 360_361ins168 |
| 5 | mouse | 21769 | Zfand3 | zinc finger, AN1-type domain 3 | XM_006524027.1 | 92.2% | 95.5% | (many diffs) |
| 6 | mouse | 21769 | Zfand3 | zinc finger, AN1-type domain 3 | NM_148926.2 | 82.9% | 85.9% | (many diffs) |
| 7 | mouse | 21769 | Zfand3 | zinc finger, AN1-type domain 3 | XM_006524028.2 | 82.8% | 85% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 747
- ORF length:
- 681
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttgccatggg agacgctggg agcgagcgca gcaaagcgcc cagcctgccg cctcgctgtc 121 cctgcggctt ctgggggtcc agcaagacta tgaatctctg ttccaaatgc tttgctgatt 181 ttcaaaagaa acagccagac gatgattccg ctccaagtac aagtaacagc caatcagatt 241 tgttttccga agagaccacc agtgacaaca acaatacctc gataaccacg ccaactctta 301 gtcccagcca gcagccgctt ccgacagaac tgaatgtaac ttcaccgagt aaagaggagt 361 gtgggccatg cacagacaca gctcatgtct cattaatcac accaacaaaa agatcctgtg 421 gtacagattc acagtctgag aatgaggctt caccagtaaa acggccacga ctacttgaga 481 atacggaacg gtccgaggaa accagtcgat ctaaacagaa gagtcgacgt cggtgcttcc 541 agtgccaaac caaactGGAG CTGGTGCAGC AGGAATTGGG ATCGTGTCGC TGCGGTTATG 601 TGTTCTGTAT GTTACATCGC CTCCCCGAGC AGCACGACTG CACATTCGAC CACATGGGCC 661 GTGGCCGGGA GGAAGCCATC ATGAAAATGG TGAAGCTGGA CCGGAAAGTG GGGCGCTCCT 721 GCCAGCGCAT CGGGGAGGGG TGCTCCTGAA GGCCAGGCAT GGCCACCACG TGACGCTGTT 781 CTTAGTTCAC TAATGTTAGC CTTATTTAGG ACAAAGTCAG CCAGACACCT TGTACTGGGC 841 ACGCGTCAGA CTGCAGCCAG TCCGTTTCCT TTCTTTAGCC AGCCATCCTG GTACTGTAGT 901 TTAGGGGTTG ATGGTGGTTG AAATTGATTT CTGGCTGGTT ACTAAGGTGC CTGCTAGCCA 961 TTGTATAAAA TTAAAACATG AAGAATATTT TAAAAAAAAA AAAAAGGGCG GCCGCTCTAG 1021 AGTATCCCTC GAGGGGCCCA AGCTTACGCG TACCCAGCTT TCTTGTACAA AGTGGTTGAT 1081 ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT 1141 CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGGAA 1201 CTAAGGTCCT CACAGTTAAT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt 1261 gtgaaagatt