Transcript: Mouse NM_148926.2

Mus musculus zinc finger, AN1-type domain 3 (Zfand3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Zfand3 (21769)
Length:
2664
CDS:
152..769

Additional Resources:

NCBI RefSeq record:
NM_148926.2
NBCI Gene record:
Zfand3 (21769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_148926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106378 CGACTGTACGTTCGACCACAT pLKO.1 655 CDS 100% 4.050 5.670 N Zfand3 n/a
2 TRCN0000106377 TGAATGTAACTTCACCGAGTA pLKO.1 417 CDS 100% 4.050 5.670 N Zfand3 n/a
3 TRCN0000106375 CGCTGTTCTTAGTTCACTAAT pLKO.1 794 3UTR 100% 13.200 9.240 N Zfand3 n/a
4 TRCN0000106379 ACTATGAATCTCTGTTCCAAA pLKO.1 233 CDS 100% 4.950 3.465 N Zfand3 n/a
5 TRCN0000106376 CAAGTACAAGTAACAGCCAAT pLKO.1 300 CDS 100% 4.050 2.835 N Zfand3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03899 pDONR223 97.8% 82.9% 85.9% None (many diffs) n/a
2 ccsbBroad304_03899 pLX_304 0% 82.9% 85.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473314 GATTCGATCCCTTGTCTCTCTAAG pLX_317 41.6% 82.9% 85.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000481283 GGAACTAAGGTCCTCACAGTTAAT pLX_317 50.2% 82.9% 85.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV