Transcript: Mouse XM_006524028.2

PREDICTED: Mus musculus zinc finger, AN1-type domain 3 (Zfand3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfand3 (21769)
Length:
2638
CDS:
170..790

Additional Resources:

NCBI RefSeq record:
XM_006524028.2
NBCI Gene record:
Zfand3 (21769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427349 CACAGCTCATGTCTCATTAAT pLKO_005 418 CDS 100% 15.000 21.000 N ZFAND3 n/a
2 TRCN0000106378 CGACTGTACGTTCGACCACAT pLKO.1 676 CDS 100% 4.050 5.670 N Zfand3 n/a
3 TRCN0000106377 TGAATGTAACTTCACCGAGTA pLKO.1 372 CDS 100% 4.050 5.670 N Zfand3 n/a
4 TRCN0000106375 CGCTGTTCTTAGTTCACTAAT pLKO.1 815 3UTR 100% 13.200 9.240 N Zfand3 n/a
5 TRCN0000106379 ACTATGAATCTCTGTTCCAAA pLKO.1 188 CDS 100% 4.950 3.465 N Zfand3 n/a
6 TRCN0000106376 CAAGTACAAGTAACAGCCAAT pLKO.1 255 CDS 100% 4.050 2.835 N Zfand3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03899 pDONR223 97.8% 82.8% 85% None (many diffs) n/a
2 ccsbBroad304_03899 pLX_304 0% 82.8% 85% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473314 GATTCGATCCCTTGTCTCTCTAAG pLX_317 41.6% 82.8% 85% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000481283 GGAACTAAGGTCCTCACAGTTAAT pLX_317 50.2% 82.8% 85% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV