Construct: ORF TRCN0000481357
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008442.2_s317c1
- Derived from:
- ccsbBroadEn_15746
- DNA Barcode:
- CCGACATATTCGCACACAATTTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WDFY3 (23001)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481357
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_017007909.1 | 9.7% | 9.8% | 1_7755del;8307C>T |
| 2 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531765.3 | 7.9% | 8% | 1_9684del;10236C>T |
| 3 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531764.3 | 7.9% | 7.9% | 1_9705del;10257C>T |
| 4 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | NM_014991.5 | 7.9% | 7.9% | 1_9735del;10287C>T |
| 5 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531763.3 | 7.9% | 7.9% | 1_9735del;10287C>T |
| 6 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531762.3 | 7.9% | 7.9% | 1_9738del;10290C>T |
| 7 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531761.3 | 7.9% | 7.9% | 1_9744del;10296C>T |
| 8 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_005262858.5 | 7.9% | 7.9% | 1_9789del;10341C>T |
| 9 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531757.3 | 7.9% | 7.9% | 1_9789del;10341C>T |
| 10 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531759.2 | 7.9% | 7.9% | 1_9789del;10341C>T |
| 11 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_011531760.3 | 7.9% | 7.9% | 1_9789del;10341C>T |
| 12 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_017007906.2 | 7.9% | 7.9% | 1_9789del;10341C>T |
| 13 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_017007907.2 | 7.9% | 7.9% | 1_9789del;10341C>T |
| 14 | human | 23001 | WDFY3 | WD repeat and FYVE domain c... | XM_017007908.2 | 7.9% | 7.9% | 1_9789del;10341C>T |
| 15 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535227.3 | 7% | 7.5% | (many diffs) |
| 16 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | NM_172882.3 | 6.9% | 7.4% | (many diffs) |
| 17 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535226.3 | 6.9% | 7.4% | (many diffs) |
| 18 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535225.3 | 6.9% | 7.4% | (many diffs) |
| 19 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535224.3 | 6.9% | 7.4% | (many diffs) |
| 20 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535220.3 | 6.9% | 7.4% | (many diffs) |
| 21 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535221.2 | 6.9% | 7.4% | (many diffs) |
| 22 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535222.3 | 6.9% | 7.4% | (many diffs) |
| 23 | mouse | 72145 | Wdfy3 | WD repeat and FYVE domain c... | XM_006535223.3 | 6.9% | 7.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 909
- ORF length:
- 843
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga atttttgcaa gttcctgaaa caccagctcc tgagcctgct gaagtcctag 121 aaatgcagga agactgtcca gaagcacaaa tagggcagga agcccaagac gaggacagca 181 gtgattcaga agcagatgag cagagcatca gccaggaccc taaggacact ccaagccaac 241 ccagcagcac cagccacagg ccccgggcag cctcctgccg cgcaacagcc gcctggtgta 301 ctgacagtgg ctctgacgac tccagacgct ggtccgacca gctcagtcta gatgagaaag 361 acggcttcat atttgtgaac tattcagagg gccagaccag agcccatctg cagggccccc 421 ttagccaccc ccaccccaat cccattgagg tgcggaatta cagcagattg aaacctgggt 481 accgatggga acggcagctg gtgttCAGGA GTAAGCTGAC TATGCACACA GCCTTTGATC 541 GAAAGGACAA TGCACACCCA GCTGAGGTCA CTGCCTTGGG CATCTCCAAG GATCACAGTA 601 GGATCCTCGT TGGTGATAGT CGAGGCCGAG TTTTCAGCTG GTCTGTGAGT GACCAGCCAG 661 GCCGTTCTGC TGCTGATCAC TGGGTGAAGG ATGAAGGTGG TGACAGCTGC TCAGGCTGCT 721 CGGTGAGGTT TTCACTCACA GAAAGACGAC ACCATTGCAG GAACTGTGGT CAGCTCTTCT 781 GCCAGAAGTG CAGTCGCTTT CAATCTGAAA TCAAACGCTT GAAAATCTCA TCCCCGGTGC 841 GTGTTTGTCA GAACTGTTAT TATAACTTAC AGCATGAGAG AGGTTCAGAA GATGGGCCTC 901 GAAATTGTTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 961 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1021 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACCGACA TATTCGCACA CAATTTTGAC 1081 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt