Construct: ORF TRCN0000481375
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017523.3_s317c1
- Derived from:
- ccsbBroadEn_14652
- DNA Barcode:
- GTTCAACTCTAATCACCCACGGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GALK2 (2585)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481375
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2585 | GALK2 | galactokinase 2 | NM_002044.4 | 99.9% | 100% | 1221C>T |
| 2 | human | 2585 | GALK2 | galactokinase 2 | XM_005254279.4 | 98% | 96.9% | (many diffs) |
| 3 | human | 2585 | GALK2 | galactokinase 2 | XM_006720461.4 | 97.6% | 97.1% | (many diffs) |
| 4 | human | 2585 | GALK2 | galactokinase 2 | NM_001001556.3 | 96.3% | 96.2% | (many diffs) |
| 5 | human | 2585 | GALK2 | galactokinase 2 | NM_001289030.2 | 94.6% | 94.7% | 0_1ins72;1149C>T |
| 6 | human | 2585 | GALK2 | galactokinase 2 | NM_001289031.1 | 94.6% | 94.7% | 0_1ins72;1149C>T |
| 7 | human | 2585 | GALK2 | galactokinase 2 | XM_005254280.4 | 94.4% | 93.3% | (many diffs) |
| 8 | human | 2585 | GALK2 | galactokinase 2 | XM_006720462.4 | 92.8% | 91.8% | (many diffs) |
| 9 | human | 2585 | GALK2 | galactokinase 2 | XM_024449892.1 | 92.8% | 91.8% | (many diffs) |
| 10 | human | 2585 | GALK2 | galactokinase 2 | XM_006720463.4 | 90.9% | 89.9% | (many diffs) |
| 11 | human | 2585 | GALK2 | galactokinase 2 | XM_017022062.2 | 87.4% | 87.5% | 0_1ins72;432_433ins99;1050C>T |
| 12 | human | 2585 | GALK2 | galactokinase 2 | XM_005254284.4 | 87.4% | 86.2% | (many diffs) |
| 13 | human | 2585 | GALK2 | galactokinase 2 | XM_024449893.1 | 86.9% | 86.3% | (many diffs) |
| 14 | human | 2585 | GALK2 | galactokinase 2 | XM_024449894.1 | 85.7% | 84.7% | (many diffs) |
| 15 | human | 2585 | GALK2 | galactokinase 2 | XM_006720464.4 | 79.9% | 78.9% | (many diffs) |
| 16 | human | 2585 | GALK2 | galactokinase 2 | XM_017022063.2 | 76.4% | 75.3% | (many diffs) |
| 17 | human | 2585 | GALK2 | galactokinase 2 | XM_011521441.3 | 70.2% | 69.3% | (many diffs) |
| 18 | human | 2585 | GALK2 | galactokinase 2 | XM_017022064.2 | 70.2% | 69.3% | (many diffs) |
| 19 | human | 2585 | GALK2 | galactokinase 2 | NM_001352047.1 | 69.7% | 69.3% | (many diffs) |
| 20 | human | 2585 | GALK2 | galactokinase 2 | NM_001352048.1 | 69.7% | 69.3% | (many diffs) |
| 21 | human | 2585 | GALK2 | galactokinase 2 | XM_024449895.1 | 64.5% | 64.6% | 0_1ins387;117_118ins99;735C>T |
| 22 | human | 2585 | GALK2 | galactokinase 2 | XR_001751207.2 | 63.6% | 1_91del;1058_1227del;1302_1303ins333 | |
| 23 | human | 2585 | GALK2 | galactokinase 2 | XR_001751204.2 | 33% | (many diffs) | |
| 24 | human | 2585 | GALK2 | galactokinase 2 | XR_001751202.2 | 32.3% | (many diffs) | |
| 25 | human | 2585 | GALK2 | galactokinase 2 | XR_001751205.2 | 31.9% | (many diffs) | |
| 26 | human | 2585 | GALK2 | galactokinase 2 | XR_002957633.1 | 31.3% | (many diffs) | |
| 27 | human | 2585 | GALK2 | galactokinase 2 | XR_001751206.2 | 31% | (many diffs) | |
| 28 | human | 2585 | GALK2 | galactokinase 2 | XR_001751208.2 | 30% | (many diffs) | |
| 29 | human | 2585 | GALK2 | galactokinase 2 | NR_147895.2 | 26.2% | (many diffs) | |
| 30 | mouse | 69976 | Galk2 | galactokinase 2 | NM_001291002.1 | 84.9% | 88.8% | (many diffs) |
| 31 | mouse | 69976 | Galk2 | galactokinase 2 | NM_175154.3 | 82% | 85% | (many diffs) |
| 32 | mouse | 69976 | Galk2 | galactokinase 2 | XM_006500153.3 | 80.6% | 84% | (many diffs) |
| 33 | mouse | 69976 | Galk2 | galactokinase 2 | XM_011239770.2 | 80.6% | 84% | (many diffs) |
| 34 | mouse | 69976 | Galk2 | galactokinase 2 | XM_006500154.1 | 69.8% | 70% | (many diffs) |
| 35 | mouse | 69976 | Galk2 | galactokinase 2 | XM_011239772.1 | 49.7% | 51% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1440
- ORF length:
- 1374
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tacagagagc cctgctacgc gtcgggtcca ggtggcagaa catcctaggt 121 tactgaagct aaaggagatg tttaactcca agtttggatc tattcccaag ttttatgttc 181 gagcaccagg aagagtcaac ataataggag agcatataga ttattgtgga tattctgttc 241 ttcctatggc tgtagaacaa gatgtgctaa tagctgtaga acctgtgaaa acgtacgctc 301 tccaactggc caatacaaat cccttgtatc cggacttcag tactagtgct aataacatcc 361 agattgataa aaccaagcct ttgtggcaca actatttctt atgtggactt aaaggaattc 421 aggaacactt tggtcttagt aacctgactg gaatgaactg cctggtagat ggaaatatcc 481 caccaagttc tggcctctcc agctccagtg ctttggtctg ttgtgctggc ttggtgacgc 541 tcacagtgct gggaaggaat ctatccaagg tggaacttgc agaaatctgt gccaagagtg 601 agcgttacat tggcactgaa ggaggaggca tggaccagtc tatatcattt cttgcagaag 661 aaggaactgc caagttgata gaatttagtc ctctgagggc aaccgatgta aaactcccaa 721 gtggagcagt gtttgtgatt gccaacagtt gtgtggagat gaataaggca gcaacttccc 781 atttcaatat cagggtgatg gagtgtcggc tggctgcgaa gctcctggct aaatacaaaa 841 gcttgcaatg ggacaaagta ctgaggctgg aggaggtgca ggctaaacta gggattagtc 901 tagaagaaat gctgttggtc acagaagatg cccttcatcc tgaaccctat aaccctgagg 961 agatctgcag gtgtctggga attagcctgg aggaactccg aacccaaatc ctgagtccaa 1021 acactcaaga tgtgcTCATC TTCAAACTCT ATCAGCGGGC AAAGCATGTG TACAGCGAGG 1081 CTGCGCGAGT GCTCCAGTTT AAGAAGATAT GTGAAGAAGC ACCTGAAAAC ATGGTCCAGC 1141 TGCTGGGAGA GTTGATGAAC CAGAGCCACA TGAGCTGCCG GGACATGTAT GAGTGCAGCT 1201 GCCCCGAGCT GGATCAGCTG GTGGACATCT GTCGGAAGTT TGGGGCTCAA GGGTCACGAC 1261 TTACTGGAGC AGGATGGGGA GGCTGTACAG TATCAATGGT ACCTGCGGAC AAGCTGCCCA 1321 GCTTTCTAGC AAATGTGCAC AAAGCTTATT ACCAGAGGAG TGATGGAAGC TTAGCACCGG 1381 AGAAGCAAAG TTTGTTTGCT ACCAAACCTG GAGGTGGGGC TTTGGTTTTG CTTGAGGCCT 1441 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1501 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1561 TTTATATATC TTGTGGAAAG GACGAGTTCA ACTCTAATCA CCCACGGGCA CGCGTTAAGT 1621 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt