Construct: ORF TRCN0000481484
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013136.2_s317c1
- Derived from:
- ccsbBroadEn_15619
- DNA Barcode:
- ATTGATATTTCACTACGCATATTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VDAC2 (7417)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481484
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001184823.1 | 96.2% | 96.2% | 1_33del |
2 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001324088.1 | 96.2% | 96.2% | 1_33del |
3 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_003375.4 | 96.2% | 96.2% | 1_33del |
4 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001184783.2 | 91.5% | 91.5% | 1_78del |
5 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001324087.1 | 88.2% | 86.5% | (many diffs) |
6 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001324089.1 | 88.2% | 86.5% | (many diffs) |
7 | human | 7417 | VDAC2 | voltage dependent anion cha... | NM_001324090.1 | 88.2% | 86.5% | (many diffs) |
8 | mouse | 22334 | Vdac2 | voltage-dependent anion cha... | NM_011695.2 | 88.9% | 93.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 915
- ORF length:
- 849
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg tattcctcca tcatatgctg accttggcaa agctgccaga gatattttca 121 acaaaggatt tggttttggg ttggtgaaac tggatgtgaa aacaaagtct tgcagtggcg 181 tggaattttc aacgtccggt tcatctaata cagacactgg taaagttact gggaccttgg 241 agaccaaata caagtggtgt gagtatggtc tgactttcac agaaaagtgg aacactgata 301 acactctggg aacagaaatc gcaattgaag accagatttg tcaaggtttg aaactgacat 361 ttgatactac cttctcacca aacacaggaa agaaaagtgg taaaatcaag tcttcttaca 421 agagggagtg tataaaCCTT GGTTGTGATG TTGACTTTGA TTTTGCTGGA CCTGCAATCC 481 ATGGTTCAGC TGTCTTTGGT TATGAGGGCT GGCTTGCTGG CTACCAGATG ACCTTTGACA 541 GTGCCAAATC AAAGCTGACA AGGAATAACT TTGCAGTGGG CTACAGGACT GGGGACTTCC 601 AGCTACACAC TAATGTCAAT GATGGGACAG AATTTGGAGG ATCAATTTAT CAGAAAGTTT 661 GTGAAGATCT TGACACTTCA GTAAACCTTG CTTGGACATC AGGTACCAAC TGCACTCGTT 721 TTGGCATTGC AGCTAAATAT CAGTTGGATC CCACTGCTTC CATTTCTGCA AAAGTCAACA 781 ACTCTAGCTT AATTGGAGTA GGCTATACTC AGACTCTGAG GCCTGGTGTG AAGCTTACAC 841 TCTCTGCTCT GGTAGATGGG AAGAGCATTA ATGCTGGAGG CCACAAGGTT GGGCTCGCCC 901 TGGAGTTGGA GGCTTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 961 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1021 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA ATTGATATTT CACTACGCAT 1081 ATTTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt