Construct: ORF TRCN0000481520
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014159.1_s317c1
- Derived from:
- ccsbBroadEn_10046
- DNA Barcode:
- CCAATCGCTGTGAGAAACAAAACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MYBPHL (343263)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481520
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 343263 | MYBPHL | myosin binding protein H like | NM_001010985.3 | 99.8% | 99.7% | 702T>C;805G>A |
2 | human | 343263 | MYBPHL | myosin binding protein H like | XM_017001173.1 | 99.8% | 99.7% | 702T>C;805G>A |
3 | human | 343263 | MYBPHL | myosin binding protein H like | XM_017001174.1 | 99.8% | 99.7% | 702T>C;805G>A |
4 | human | 343263 | MYBPHL | myosin binding protein H like | NM_001265613.2 | 93.3% | 93.2% | 360_361ins69;633T>C;736G>A |
5 | human | 343263 | MYBPHL | myosin binding protein H like | XM_017001175.1 | 93.3% | 93.2% | 360_361ins69;633T>C;736G>A |
6 | mouse | 68753 | Mybphl | myosin binding protein H-like | NM_026831.1 | 85.1% | 82.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1131
- ORF length:
- 1062
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaggcagcc acagctccgg aggtggccgc aggatccaag ctgaaggtga 121 aagaagccag cccagcggat gctgaaccac cccaggcttc acctggacag ggggctggca 181 gccccactcc ccagctcctg ccccctatag aagagcaccc caagatctgg ctacctcggg 241 ccctgaggca gacctacatc cggaaggttg gggacacagt gaacctacta atcccattcc 301 agggcaagcc caaacctcaa gccatctgga cacatgatgg ctgtgccttg gacaccaggc 361 gtgtgagtgt gcggaatggg gagcaagact ccatcctctt catccgagaa gcccaacgtg 421 ctgactcagg tcgctaccaa ctccgcgtgc agctgggtgg gctggaggcc accgccacca 481 ttgacatcct ggtgattgag aggccaggcc ctcctcagag tattaagctg gtggacgttt 541 ggggcttcag cgctacactg gaatggacac cgccccaaga tacggggaat acagcacttc 601 tgggatacac ggtgcagaag gctgacacaa aatccgggct gtggttcacg gtgctggagc 661 actatcaccg caccagctgc atcgtctctg acctcatcat cggcaactcc tatgccttcc 721 gtgtctttgc tgaaaaccag tgcggactca gtgaaacagc ccccatcacc acggaccTCG 781 CCCACATCCA GAAAGCAGCT ACTGTTTACA AGACCAAGGG GTTTGCCCAA CGAGACTTCT 841 CTGAAGCCCC AAAGTTTACC CAGCCTCTGG CCAACTGCAC TACAGTCACC GGCTATAATA 901 CCCAGCTCTT CTGCTGTGTC CGCGCCTCTC CCCGGCCCAA GATCATCTGG CTGAAGAACA 961 AGATGGATAT CCAAGGCAAC CCTAAGTACA GAGCCCTGAC TCACCTGGGA ATCTGCTCCC 1021 TAGAGATCCG CAAGCCGGGT CCCTTTGATG GAGGCATCTA TACCTGCAAG GCGGTGAACC 1081 CCCTAGGGGA GGCATCTGTG GACTGTCGGG TGGATGTGAA AGTTCCTAAT TTGCCAACTT 1141 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1201 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1261 CTTGTGGAAA GGACGACCAA TCGCTGTGAG AAACAAAACT ACGCGTTAAG TCgacaatca 1321 acctctggat tacaaaattt gtgaaagatt