Transcript: Human NM_001265613.2

Homo sapiens myosin binding protein H like (MYBPHL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
MYBPHL (343263)
Length:
1273
CDS:
21..1016

Additional Resources:

NCBI RefSeq record:
NM_001265613.2
NBCI Gene record:
MYBPHL (343263)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001265613.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444028 AGGCATGGTACTCTGACAAAG pLKO_005 1029 3UTR 100% 10.800 15.120 N MYBPHL n/a
2 TRCN0000117038 CGGCTATAATACCCAGCTCTT pLKO.1 773 CDS 100% 4.050 5.670 N MYBPHL n/a
3 TRCN0000117039 CCTTTGATGGAGGCATCTATA pLKO.1 925 CDS 100% 13.200 9.240 N MYBPHL n/a
4 TRCN0000419756 TCCTAATTGAGGACACCTAAG pLKO_005 1007 CDS 100% 6.000 4.200 N MYBPHL n/a
5 TRCN0000117040 CAGTGAACCTACTAATCCCAT pLKO.1 229 CDS 100% 2.640 1.848 N MYBPHL n/a
6 TRCN0000117037 CCAGCAATGAAGTGAATTCAT pLKO.1 1057 3UTR 100% 0.000 0.000 N MYBPHL n/a
7 TRCN0000117041 GAAAGCAGCTACTGTTTACAA pLKO.1 674 CDS 100% 5.625 3.375 N MYBPHL n/a
8 TRCN0000089758 CCCTCCTCAGAGTATTAAGTT pLKO.1 392 CDS 100% 5.625 3.938 N Mybphl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001265613.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10046 pDONR223 100% 93.3% 93.2% None 360_361ins69;633T>C;736G>A n/a
2 ccsbBroad304_10046 pLX_304 0% 93.3% 93.2% V5 360_361ins69;633T>C;736G>A n/a
3 TRCN0000481520 CCAATCGCTGTGAGAAACAAAACT pLX_317 33.5% 93.3% 93.2% V5 360_361ins69;633T>C;736G>A n/a
4 ccsbBroadEn_10045 pDONR223 100% 93.1% 93.2% None (many diffs) n/a
5 ccsbBroad304_10045 pLX_304 0% 93.1% 93.2% V5 (many diffs) n/a
Download CSV