Transcript: Human XM_017001173.1

PREDICTED: Homo sapiens myosin binding protein H like (MYBPHL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYBPHL (343263)
Length:
3601
CDS:
2404..3468

Additional Resources:

NCBI RefSeq record:
XM_017001173.1
NBCI Gene record:
MYBPHL (343263)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444028 AGGCATGGTACTCTGACAAAG pLKO_005 3481 3UTR 100% 10.800 15.120 N MYBPHL n/a
2 TRCN0000117038 CGGCTATAATACCCAGCTCTT pLKO.1 3225 CDS 100% 4.050 5.670 N MYBPHL n/a
3 TRCN0000117039 CCTTTGATGGAGGCATCTATA pLKO.1 3377 CDS 100% 13.200 9.240 N MYBPHL n/a
4 TRCN0000419756 TCCTAATTGAGGACACCTAAG pLKO_005 3459 CDS 100% 6.000 4.200 N MYBPHL n/a
5 TRCN0000117040 CAGTGAACCTACTAATCCCAT pLKO.1 2612 CDS 100% 2.640 1.848 N MYBPHL n/a
6 TRCN0000117041 GAAAGCAGCTACTGTTTACAA pLKO.1 3126 CDS 100% 5.625 3.375 N MYBPHL n/a
7 TRCN0000089758 CCCTCCTCAGAGTATTAAGTT pLKO.1 2844 CDS 100% 5.625 3.938 N Mybphl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10046 pDONR223 100% 99.8% 99.7% None 702T>C;805G>A n/a
2 ccsbBroad304_10046 pLX_304 0% 99.8% 99.7% V5 702T>C;805G>A n/a
3 TRCN0000481520 CCAATCGCTGTGAGAAACAAAACT pLX_317 33.5% 99.8% 99.7% V5 702T>C;805G>A n/a
4 ccsbBroadEn_10045 pDONR223 100% 99.6% 99.7% None (many diffs) n/a
5 ccsbBroad304_10045 pLX_304 0% 99.6% 99.7% V5 (many diffs) n/a
Download CSV