Construct: ORF TRCN0000487687
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019146.1_s317c1
- DNA Barcode:
- TAGAAGCTAAAATCGCCGGTCACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NPR2 (4882)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487687
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | NM_003995.3 | 97.6% | 97.6% | 1814_1885del;3141_3142insG |
| 2 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_005251478.3 | 97.3% | 97.3% | 1436_1444delGTCCTTACA;1823_1894del;3150_3151insG |
| 3 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447557.1 | 92.9% | 92.8% | 1814_1885del;2048_2206del;3300_3301insG |
| 4 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447556.1 | 92.7% | 92.5% | (many diffs) |
| 5 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447558.1 | 62.9% | 62.7% | (many diffs) |
| 6 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447561.1 | 52.9% | 52.9% | 0_1ins1404;410_481del;1737_1738insG |
| 7 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447560.1 | 50.4% | 50.3% | (many diffs) |
| 8 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447559.1 | 50.3% | 50.1% | (many diffs) |
| 9 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | NM_173788.4 | 90.1% | 96.2% | (many diffs) |
| 10 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | NM_001355466.1 | 87.7% | 93.8% | (many diffs) |
| 11 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | XR_390318.4 | 42.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 3147
- ORF length:
- 3072
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggcg ctgccatcac ttctgctgtt ggtggcagcc ctggcaggtg 121 gggtgcgtcc tcccggggcg cggaacctga cgctggcggt ggtgctgcca gaacacaacc 181 tgagctatgc ctgggcctgg ccacgggtgg gacccgctgt ggcactagct gtggaggctc 241 tgggccgggc actgcccgtg gacctgcggt ttgtcagctc cgaactggaa ggcgcctgct 301 ctgagtacct ggcaccgctg agcgctgtgg acctcaagct gtaccatgac cccgacctgc 361 tgttaggtcc cggttgcgtg taccctgctg cctctgtggc ccgctttgcc tcccactggc 421 gccttcccct gctgactgcg ggtgctgtgg cctctggttt ttcggctaag aatgaccatt 481 atcgtaccct ggttcgcact ggcccctctg ctcccaagct gggtgagttt gtggtgacac 541 tacacgggca cttcaattgg actgcccgtg ctgccttgct gtacctggat gctcgcacag 601 atgaccggcc tcactacttc accatcgagg gcgtctttga ggccctgcag ggcagcaacc 661 tcagtgtgca gcaccaggtg tatgcccgag agccaggggg ccccgagcag gccacccact 721 tcatccgggc caacgggcgc attgtgtata tctgcggccc tctggagatg ctgcatgaga 781 tcctgcttca ggcccagagg gagaatctga ccaatgggga ttatgtcttc ttttacctgg 841 atgtctttgg ggagagtctc cgtgcaggcc ccacacgtgc tacaggccgg ccctggcagg 901 acaatcgcac ccgggaacag gcccaggccc tcagagaggc ctttcagact gtattggtga 961 tcacgtaccg agaaccccca aatcctgagt atcaggaatt ccagaatcgt ctgctgataa 1021 gagcccggga agactttggt gtggagctgg gcccttccct gatgaacctc atcgctggct 1081 gcttctatga tgggatcctg ctatatgctg aagtcctgaa tgagacaata caggaaggag 1141 gcacccggga ggatggactt cgaattgtgg aaaagatgca gggacgaaga tatcacggtg 1201 taactgggct ggttgtcatg gacaagaaca atgaccgaga gactgacttt gtcctctggg 1261 ccatgggaga cctggattct ggggactttc agcctgcagc ccactactcg ggagctgaga 1321 agcagatttg gtggacggga cggcctattc cctgggtgaa gggggctcct ccctcggaca 1381 atcccccctg tgcctttgac ttggacgacc catcctgtga taaaactcca ctttcaaccc 1441 tggcaattgt ggctctgggc acaggaatca ccttcatcat gtttggtgtt tccagcttcc 1501 taattttccg aaagctgatg ctggagaagg agctggctag catgttgtgg cgtattcgct 1561 gggaagaact gcagtttggc aactcagagc gttatcacaa aggtgcaggc agtcgcctca 1621 cactgtcgct gcggggatcc agttacggct cgctcatgac agcccatggg aaataccaga 1681 tctttgccaa caccggtcac ttcaagggaa atgttgtcgc catcaaacat gtgaataaga 1741 agcgcattga gctgacccgg caggttctgt ttgaactcaa acatatgaga gatgttcagt 1801 tcaaccatct cactcgcttc attggcgcct gcatagaccc tcccaacatt tgcattgtca 1861 ctgaatactg tcctcgtggg agtttacagg gcatggcctt tctccacaac agcattattt 1921 catcgcatgg gagtctcaag tcctccaact gtgtggtgga tagtcgtttt gtgctcaaaa 1981 tcacagacta tggcctggcc agcttccgat caactgctga acctgatgac agccatgccc 2041 tctatgccaa gaagctgtgg actgccccag aactgctcag tgggaacccc ttgccaacca 2101 caggcatgca gaaggctgac gtctatagct ttgggatcat cctgcaggag atagcacttc 2161 gcagtggtcc tttctacttg gagggcctgg acctcagccc caaagagatt gtccagaagg 2221 tacgaaatgg tcagcggcca tatttccggc caagcattga ccggacccaa ctgaatgaag 2281 agctagtttt gctgatggag cgatgttggg ctcaggaccc agctgagcgg ccagactttg 2341 gacagattaa gggcttcatt cggcgcttta acaaggaggg tggcaccagc atattggaca 2401 acctcctgct gcgcatggaa cagtatgcca ataacttgga gaagctggtg gaggaacgca 2461 cacaggccta tctggaggaa aaacgcaagg ctgaagctct gctctaccaa atcctacccc 2521 attcagtggc agagcagtta aaacggggag agactgtaca ggctgaggcc tttgacagtg 2581 ttaccatcta cttcagtgac attgttggct tcacagcatt gtcagcagag agcaccccca 2641 tgcaggtagt gacacttctt aatgacctgt atacctgctt tgatgccata attgacaact 2701 ttgatgtcta caaggtggag acgattgggg atgcttacat ggtggtatct ggcctcccag 2761 gccgaaatgg tcaacgccat gcaccagaaa ttgctcgtat ggccctagca ttactagatg 2821 cagtttcttc ctttcgcatc cgccaccgac cccatgacca gctgaggcta cgcatagggg 2881 tccatactgg gccagtctgt gctggggttg ttggcctgaa gatgccccgt tattgtcttt 2941 ttGGAGACAC AGTGAACACT GCTTCTCGAA TGGAGTCTAA TGGTCAAGCG CTGAAGATCC 3001 ATGTCTCCTC TACCACCAAG GATGCCCTAG ATGAGCTAGG ATGCTTCCAG CTAGAGCTTC 3061 GGGGGGATGT GGAAATGAAG GGAAAAGGAA AGATGCGAAC ATACTGGCTC TTAGGAGAGC 3121 GGAAAGGACC TCCTGGACTC CTGGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 3181 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 3241 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT AGAAGCTAAA 3301 ATCGCCGGTC ACCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 3361 att