Transcript: Human NM_003995.3

Homo sapiens natriuretic peptide receptor 2 (NPR2), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
NPR2 (4882)
Length:
3447
CDS:
1..3144

Additional Resources:

NCBI RefSeq record:
NM_003995.3
NBCI Gene record:
NPR2 (4882)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003995.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196949 GAAATGGTCAGCGGCCATATT pLKO.1 2222 CDS 100% 13.200 18.480 N NPR2 n/a
2 TRCN0000381745 GGGCTTCATTCGGCGCTTTAA pLKO_005 2349 CDS 100% 13.200 18.480 N NPR2 n/a
3 TRCN0000380228 GCTCGTATGGCCCTAGCATTA pLKO_005 2791 CDS 100% 10.800 15.120 N NPR2 n/a
4 TRCN0000320377 ATGATGGGATCCTGCTATATG pLKO_005 1013 CDS 100% 13.200 10.560 N NPR2 n/a
5 TRCN0000195536 CCAGACTTTGGACAGATTAAG pLKO.1 2329 CDS 100% 13.200 10.560 N NPR2 n/a
6 TRCN0000350251 CGGCTAAGAATGACCATTATC pLKO_005 389 CDS 100% 13.200 10.560 N NPR2 n/a
7 TRCN0000000427 CGAATGGAGTCTAATGGTCAA pLKO.1 2965 CDS 100% 4.050 3.240 N NPR2 n/a
8 TRCN0000010603 CGAATGGAGTCTAATGGTCAA pLKO.1 2965 CDS 100% 4.050 3.240 N NPR2 n/a
9 TRCN0000320452 ATGTCTGCACACACCAGAAAT pLKO_005 3208 3UTR 100% 13.200 9.240 N NPR2 n/a
10 TRCN0000000430 CACTTCTTAATGACCTGTATA pLKO.1 2651 CDS 100% 13.200 9.240 N NPR2 n/a
11 TRCN0000001315 CACTTCTTAATGACCTGTATA pLKO.1 2651 CDS 100% 13.200 9.240 N NPR2 n/a
12 TRCN0000320449 CACTTCTTAATGACCTGTATA pLKO_005 2651 CDS 100% 13.200 9.240 N NPR2 n/a
13 TRCN0000000428 CGTGGGAGTTTACAGGATATT pLKO.1 1801 CDS 100% 13.200 9.240 N NPR2 n/a
14 TRCN0000001312 CGTGGGAGTTTACAGGATATT pLKO.1 1801 CDS 100% 13.200 9.240 N NPR2 n/a
15 TRCN0000381413 GCAGCTCAGCCCTGTACATAT pLKO_005 3297 3UTR 100% 13.200 9.240 N NPR2 n/a
16 TRCN0000320451 TGGACTGGATGTTTCGTTATT pLKO_005 1844 CDS 100% 13.200 9.240 N NPR2 n/a
17 TRCN0000054839 CCAGAACACAACCTGAGCTAT pLKO.1 94 CDS 100% 4.950 3.465 N Npr2 n/a
18 TRCN0000054841 CCATGGGAAATACCAGATCTT pLKO.1 1590 CDS 100% 4.950 3.465 N Npr2 n/a
19 TRCN0000001314 GCCTTTCTCCACAACAGCATT pLKO.1 1894 CDS 100% 4.950 3.465 N NPR2 n/a
20 TRCN0000000429 GCTCTGCTCTACCAAATCCTA pLKO.1 2494 CDS 100% 3.000 2.100 N NPR2 n/a
21 TRCN0000001313 GCTCTGCTCTACCAAATCCTA pLKO.1 2494 CDS 100% 3.000 2.100 N NPR2 n/a
22 TRCN0000195529 CCAAGTCAGATAGTCTTCTGC pLKO.1 3158 3UTR 100% 2.640 1.848 N NPR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003995.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489406 GTGTGACTTTTGTTAAGCCCGTAA pLX_317 6.6% 99.9% 99.9% V5 3141_3142insG n/a
2 TRCN0000487729 TGGGCGTCAGCGAGTCGAATAAAC pLX_317 6.7% 100% 100% V5 (not translated due to prior stop codon) n/a
3 TRCN0000487687 TAGAAGCTAAAATCGCCGGTCACC pLX_317 6.8% 97.6% 97.6% V5 1814_1885del;3141_3142insG n/a
4 TRCN0000488773 GTGAGATCGTGGTGTCATCTTGTA pLX_317 11.6% 97.7% 97.7% V5 (not translated due to prior stop codon) 1814_1885del n/a
5 TRCN0000488743 CTGAGCGCTGCTCCTTTCCGGACT pLX_317 11.4% 97.7% 97.7% V5 (not translated due to prior stop codon) 1814_1885del n/a
6 TRCN0000480311 ACGACTGCCTGATAGCATTACTAG pLX_317 13.6% 93.8% 19.6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_14718 pDONR223 54.3% 93.7% 19.6% None (many diffs) n/a
8 ccsbBroad304_14718 pLX_304 0% 93.7% 19.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV