Transcript: Human XM_024447558.1

PREDICTED: Homo sapiens natriuretic peptide receptor 2 (NPR2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPR2 (4882)
Length:
3914
CDS:
1316..3640

Additional Resources:

NCBI RefSeq record:
XM_024447558.1
NBCI Gene record:
NPR2 (4882)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447558.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196949 GAAATGGTCAGCGGCCATATT pLKO.1 2718 CDS 100% 13.200 18.480 N NPR2 n/a
2 TRCN0000381745 GGGCTTCATTCGGCGCTTTAA pLKO_005 2845 CDS 100% 13.200 18.480 N NPR2 n/a
3 TRCN0000380228 GCTCGTATGGCCCTAGCATTA pLKO_005 3287 CDS 100% 10.800 15.120 N NPR2 n/a
4 TRCN0000320377 ATGATGGGATCCTGCTATATG pLKO_005 1341 CDS 100% 13.200 10.560 N NPR2 n/a
5 TRCN0000195536 CCAGACTTTGGACAGATTAAG pLKO.1 2825 CDS 100% 13.200 10.560 N NPR2 n/a
6 TRCN0000000427 CGAATGGAGTCTAATGGTCAA pLKO.1 3461 CDS 100% 4.050 3.240 N NPR2 n/a
7 TRCN0000010603 CGAATGGAGTCTAATGGTCAA pLKO.1 3461 CDS 100% 4.050 3.240 N NPR2 n/a
8 TRCN0000320452 ATGTCTGCACACACCAGAAAT pLKO_005 3704 3UTR 100% 13.200 9.240 N NPR2 n/a
9 TRCN0000000430 CACTTCTTAATGACCTGTATA pLKO.1 3147 CDS 100% 13.200 9.240 N NPR2 n/a
10 TRCN0000001315 CACTTCTTAATGACCTGTATA pLKO.1 3147 CDS 100% 13.200 9.240 N NPR2 n/a
11 TRCN0000320449 CACTTCTTAATGACCTGTATA pLKO_005 3147 CDS 100% 13.200 9.240 N NPR2 n/a
12 TRCN0000000428 CGTGGGAGTTTACAGGATATT pLKO.1 2138 CDS 100% 13.200 9.240 N NPR2 n/a
13 TRCN0000001312 CGTGGGAGTTTACAGGATATT pLKO.1 2138 CDS 100% 13.200 9.240 N NPR2 n/a
14 TRCN0000381413 GCAGCTCAGCCCTGTACATAT pLKO_005 3793 3UTR 100% 13.200 9.240 N NPR2 n/a
15 TRCN0000320451 TGGACTGGATGTTTCGTTATT pLKO_005 2181 CDS 100% 13.200 9.240 N NPR2 n/a
16 TRCN0000054841 CCATGGGAAATACCAGATCTT pLKO.1 1927 CDS 100% 4.950 3.465 N Npr2 n/a
17 TRCN0000001314 GCCTTTCTCCACAACAGCATT pLKO.1 2231 CDS 100% 4.950 3.465 N NPR2 n/a
18 TRCN0000000429 GCTCTGCTCTACCAAATCCTA pLKO.1 2990 CDS 100% 3.000 2.100 N NPR2 n/a
19 TRCN0000001313 GCTCTGCTCTACCAAATCCTA pLKO.1 2990 CDS 100% 3.000 2.100 N NPR2 n/a
20 TRCN0000195529 CCAAGTCAGATAGTCTTCTGC pLKO.1 3654 3UTR 100% 2.640 1.848 N NPR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447558.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489406 GTGTGACTTTTGTTAAGCCCGTAA pLX_317 6.6% 65% 64.9% V5 (many diffs) n/a
2 TRCN0000487729 TGGGCGTCAGCGAGTCGAATAAAC pLX_317 6.7% 65% 65% V5 (not translated due to prior stop codon) 0_1ins987;449_457delGTCCTTACA;1070_1228del n/a
3 TRCN0000487687 TAGAAGCTAAAATCGCCGGTCACC pLX_317 6.8% 62.9% 62.7% V5 (many diffs) n/a
4 TRCN0000488773 GTGAGATCGTGGTGTCATCTTGTA pLX_317 11.6% 62.9% 62.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488743 CTGAGCGCTGCTCCTTTCCGGACT pLX_317 11.4% 62.9% 62.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000480311 ACGACTGCCTGATAGCATTACTAG pLX_317 13.6% 59.5% 3.5% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_14718 pDONR223 54.3% 59.4% 3.5% None (many diffs) n/a
8 ccsbBroad304_14718 pLX_304 0% 59.4% 3.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV