Transcript: Mouse NM_173788.4

Mus musculus natriuretic peptide receptor 2 (Npr2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-11
Taxon:
Mus musculus (mouse)
Gene:
Npr2 (230103)
Length:
3853
CDS:
251..3394

Additional Resources:

NCBI RefSeq record:
NM_173788.4
NBCI Gene record:
Npr2 (230103)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173788.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276670 GAATGGTCAGAGGCCGTATTT pLKO_005 2473 CDS 100% 13.200 18.480 N Npr2 n/a
2 TRCN0000054840 GATGCCATTATCGACAACTTT pLKO.1 2930 CDS 100% 5.625 7.875 N Npr2 n/a
3 TRCN0000054838 GCATTATTTCATCTCATGGAA pLKO.1 2160 CDS 100% 3.000 2.400 N Npr2 n/a
4 TRCN0000028811 CCATCCCTGATGAACCTTATT pLKO.1 1229 CDS 100% 13.200 9.240 N Npr2 n/a
5 TRCN0000028763 GCAGCTAAGAATGAGCATTAT pLKO.1 638 CDS 100% 13.200 9.240 N Npr2 n/a
6 TRCN0000276672 GCAGCTAAGAATGAGCATTAT pLKO_005 638 CDS 100% 13.200 9.240 N Npr2 n/a
7 TRCN0000054842 GCAGGTGGTGACACTTCTTAA pLKO.1 2890 CDS 100% 13.200 9.240 N Npr2 n/a
8 TRCN0000028785 GCCATCATTCTACAGGAAATA pLKO.1 2381 CDS 100% 13.200 9.240 N Npr2 n/a
9 TRCN0000276733 TTGCCATCAAACACGTGAATA pLKO_005 1893 CDS 100% 13.200 9.240 N Npr2 n/a
10 TRCN0000276671 CTGGTACTTGGATGGGCAATG pLKO_005 3420 3UTR 100% 6.000 4.200 N Npr2 n/a
11 TRCN0000028826 GCCCTGCTGTACCAAATTCTA pLKO.1 2744 CDS 100% 5.625 3.938 N Npr2 n/a
12 TRCN0000054839 CCAGAACACAACCTGAGCTAT pLKO.1 344 CDS 100% 4.950 3.465 N Npr2 n/a
13 TRCN0000054841 CCATGGGAAATACCAGATCTT pLKO.1 1840 CDS 100% 4.950 3.465 N Npr2 n/a
14 TRCN0000001314 GCCTTTCTCCACAACAGCATT pLKO.1 2144 CDS 100% 4.950 3.465 N NPR2 n/a
15 TRCN0000028793 GCTTCTCGAATGGAGTCGAAT pLKO.1 3209 CDS 100% 4.950 3.465 N Npr2 n/a
16 TRCN0000276673 GCTTCTCGAATGGAGTCGAAT pLKO_005 3209 CDS 100% 4.950 3.465 N Npr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173788.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489406 GTGTGACTTTTGTTAAGCCCGTAA pLX_317 6.6% 92.2% 98.5% V5 (many diffs) n/a
2 TRCN0000487729 TGGGCGTCAGCGAGTCGAATAAAC pLX_317 6.7% 92.2% 98.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000487687 TAGAAGCTAAAATCGCCGGTCACC pLX_317 6.8% 90.1% 96.2% V5 (many diffs) n/a
4 TRCN0000488773 GTGAGATCGTGGTGTCATCTTGTA pLX_317 11.6% 90.1% 96.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488743 CTGAGCGCTGCTCCTTTCCGGACT pLX_317 11.4% 90.1% 96.3% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000480311 ACGACTGCCTGATAGCATTACTAG pLX_317 13.6% 86.8% 19.2% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_14718 pDONR223 54.3% 86.7% 19.2% None (many diffs) n/a
8 ccsbBroad304_14718 pLX_304 0% 86.7% 19.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV