Construct: ORF TRCN0000487712
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021924.1_s317c1
- DNA Barcode:
- TTTGAATCTACGGTTTCAAGCTCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- FLT3 (2322)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487712
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | NM_004119.3 | 99.9% | 99.8% | 288C>T;2522A>T |
2 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | NM_004119.2:c.2508_2510del | 99.8% | 99.7% | 288C>T;2505_2506insATC;2519A>T |
3 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_011535015.2 | 98% | 97.9% | 0_1ins57;231C>T;2465A>T |
4 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020486.1 | 92.6% | 92.6% | 288C>T;740_741ins216;2306A>T |
5 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_011535017.2 | 82.3% | 82.2% | 0_1ins525;1997A>T |
6 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_011535018.2 | 82.3% | 82.2% | 0_1ins525;1997A>T |
7 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020487.1 | 82.3% | 82.2% | 0_1ins525;1997A>T |
8 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | NR_130706.2 | 75.2% | (many diffs) | |
9 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020488.1 | 70.4% | 67.8% | 0_1ins803;77_78ins76;1643A>T |
10 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020489.1 | 69.8% | 69.7% | 0_1ins897;1625A>T |
11 | mouse | 14255 | Flt3 | FMS-like tyrosine kinase 3 | NM_010229.2 | 82.5% | 85.4% | (many diffs) |
12 | mouse | 14255 | Flt3 | FMS-like tyrosine kinase 3 | XM_006504804.3 | 51.6% | 53.1% | (many diffs) |
13 | mouse | 14255 | Flt3 | FMS-like tyrosine kinase 3 | XM_006504805.3 | 47.6% | 50.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 3051
- ORF length:
- 2979
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgccggcg ttggcgcgcg acggcggcca gctgccgctg ctcgttgttt 121 tttctgcaat gatatttggg actattacaa atcaagatct gcctgtgatc aagtgtgttt 181 taatcaatca taagaacaat gattcatcag tggggaagtc atcatcatat cccatggtat 241 cagaatcccc ggaagacctc gggtgtgcgt tgagacccca gagctcaggg acagtgtacg 301 aagctgccgc tgtggaagtg gatgtatctg cttccatcac actgcaagtg ctggtcgatg 361 ccccagggaa catttcctgt ctctgggtct ttaagcacag ctccctgaat tgccagccac 421 attttgattt acaaaacaga ggagttgttt ccatggtcat tttgaaaatg acagaaaccc 481 aagctggaga atacctactt tttattcaga gtgaagctac caattacaca atattgttta 541 cagtgagtat aagaaatacc ctgctttaca cattaagaag accttacttt agaaaaatgg 601 aaaaccagga cgccctggtc tgcatatctg agagcgttcc agagccgatc gtggaatggg 661 tgctttgcga ttcacagggg gaaagctgta aagaagaaag tccagctgtt gttaaaaagg 721 aggaaaaagt gcttcatgaa ttatttggga cggacataag gtgctgtgcc agaaatgaac 781 tgggcaggga atgcaccagg ctgttcacaa tagatctaaa tcaaactcct cagaccacat 841 tgccacaatt atttcttaaa gtaggggaac ccttatggat aaggtgcaaa gctgttcatg 901 tgaaccatgg attcgggctc acctgggaat tagaaaacaa agcactcgag gagggcaact 961 actttgagat gagtacctat tcaacaaaca gaactatgat acggattctg tttgcttttg 1021 tatcatcagt ggcaagaaac gacaccggat actacacttg ttcctcttca aagcatccca 1081 gtcaatcagc tttggttacc atcgtagaaa agggatttat aaatgctacc aattcaagtg 1141 aagattatga aattgaccaa tatgaagagt tttgtttttc tgtcaggttt aaagcctacc 1201 cacaaatcag atgtacgtgg accttctctc gaaaatcatt tccttgtgag caaaagggtc 1261 ttgataacgg atacagcata tccaagtttt gcaatcataa gcaccagcca ggagaatata 1321 tattccatgc agaaaatgat gatgcccaat ttaccaaaat gttcacgctg aatataagaa 1381 ggaaacctca agtgctcgca gaagcatcgg caagtcaggc gtcctgtttc tcggatggat 1441 acccattacc atcttggacc tggaagaagt gttcagacaa gtctcccaac tgcacagaag 1501 agatcacaga aggagtctgg aatagaaagg ctaacagaaa agtgtttgga cagtgggtgt 1561 cgagcagtac tctaaacatg agtgaagcca taaaagggtt cctggtcaag tgctgtgcat 1621 acaattccct tggcacatct tgtgagacga tccttttaaa ctctccaggc cccttccctt 1681 tcatccaaga caacatctca ttctatgcaa caattggtgt ttgtctcctc ttcattgtcg 1741 ttttaaccct gctaatttgt cacaagtaca aaaagcaatt taggtatgaa agccagctac 1801 agatggtaca ggtgaccggc tcctcagata atgagtactt ctacgttgat ttcagagaat 1861 atgaatatga tctcaaatgg gagtttccaa gagaaaattt agagtttggg aaggtactag 1921 gatcaggtgc ttttggaaaa gtgatgaacg caacagctta tggaattagc aaaacaggag 1981 tctcaatcca ggttgccgtc aaaatgctga aagaaaaagc agacagctct gaaagagagg 2041 cactcatgtc agaactcaag atgatgaccc agctgggaag ccacgagaat attgtgaacc 2101 tgctgggggc gtgcacactg tcaggaccaa tttacttgat ttttgaatac tgttgctatg 2161 gtgatcttct caactatcta agaagtaaaa gagaaaaatt tcacaggact tggacagaga 2221 ttttcaagga acacaatttc agtttttacc ccactttcca atcacatcca aattccagca 2281 tgcctggttc aagagaagtt cagatacacc cggactcgga tcaaatctca gggcttcatg 2341 ggaattcatt tcactctgaa gatgaaattg aatatgaaaa ccaaaaaagg ctggaagaag 2401 aggaggactt gaatgtgctt acatttgaag atcttctttg ctttgcatat caagttgcca 2461 aaggaatgga atttctggaa tttaagtcgt gtgttcacag agacctggcc gccaggaacg 2521 tgcttgtcac ccacgggaaa gtggtgaaga tatgtgactt tggattggct cgagatatca 2581 tgagtgattc catctatgtt gtcaggggca atgcccgtct gcctgtaaaa tggatggccc 2641 ccgaaagcct gtttgaaggc atctacacca ttaagagtga tgtctggtca tatggaatat 2701 tactgtggga aatcttctca cttggtgtga atccttaccc tggcattccg gttgatgcta 2761 acttctacaa actgattcaa aatgGATTTA AAATGGATCA GCCATTTTAT GCTACAGAAG 2821 AAATATACAT TATAATGCAA TCCTGCTGGG CTTTTGACTC AAGGAAACGG CCATCCTTCC 2881 CTAATTTGAC TTCGTTTTTA GGATGTCAGC TGGCAGATGC AGAAGAAGCG ATGTATCAGA 2941 ATGTGGATGG CCGTGTTTCG GAATGTCCTC ACACCTACCA AAACAGGCGA CCTTTCAGCA 3001 GAGAGATGGA TTTGGGGCTA CTCTCTCCGC AGGCTCAGGT CGAAGATTCG TAGGACCCAG 3061 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 3121 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 3181 TATCTTGTGG AAAGGACGAT TTGAATCTAC GGTTTCAAGC TCAACGCGTT AAGTCgacaa 3241 tcaacctctg gattacaaaa tttgtgaaag att