Construct: ORF TRCN0000487749
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021789.1_s317c1
- DNA Barcode:
- GAACACGTGAAATTCCCTACACAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- IL20RB (53833)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487749
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 53833 | IL20RB | interleukin 20 receptor sub... | NM_144717.4 | 100% | 100% | |
| 2 | human | 53833 | IL20RB | interleukin 20 receptor sub... | XM_011512910.3 | 91.7% | 89.4% | (many diffs) |
| 3 | human | 53833 | IL20RB | interleukin 20 receptor sub... | XM_006713665.4 | 84.8% | 84.8% | 0_1ins141 |
| 4 | human | 53833 | IL20RB | interleukin 20 receptor sub... | XM_011512911.2 | 84.8% | 84.8% | 0_1ins141 |
| 5 | human | 53833 | IL20RB | interleukin 20 receptor sub... | XM_017006632.1 | 84.8% | 84.8% | 0_1ins141 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1002
- ORF length:
- 933
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gcagactttc acaatggttc tagaagaaat ctggacaagt cttttcatgt 121 ggtttttcta cgcattgatt ccatgtttgc tcacagatga agtggccatt ctgcctgccc 181 ctcagaacct ctctgtactc tcaaccaaca tgaagcatct cttgatgtgg agcccagtga 241 tcgcgcctgg agaaacagtg tactattctg tcgaatacca gggggagtac gagagcctgt 301 acacgagcca catctggatc cccagcagct ggtgctcact cactgaaggt cctgagtgtg 361 atgtcactga tgacatcacg gccactgtgc catacaacct tcgtgtcagg gccacattgg 421 gctcacagac ctcagcctgg agcatcctga agcatccctt taatagaaac tcaaccatcc 481 ttacccgacc tgggatggag atcaccaaag atggcttcca cctggttatt gagctggagg 541 acctggggcc ccagtttgag ttccttgtgg cctactggag gagggagcct ggtgccgagg 601 aacatgtcaa aatggtgagg agtgggggta ttccagtgca cctagaaacc atggagccag 661 gggctgcata ctgtgtgaag gcccagacat tcgtgaaggc cattgggagg tacagcgcct 721 tcagccagac agaatgtgtg gaggtgcaag gagaggccat tcccctggta ctggccctgt 781 ttgcctttgt tGGCTTCATG CTGATCCTTG TGGTCGTGCC ACTGTTCGTC TGGAAAATGG 841 GCCGGCTGCT CCAGTACTCC TGTTGCCCCG TGGTGGTCCT CCCAGACACC TTGAAAATAA 901 CCAATTCACC CCAGAAGTTA ATCAGCTGCA GAAGGGAGGA GGTGGATGCC TGTGCCACGG 961 CTGTGATGTC TCCTGAGGAA CTCCTCAGGG CCTGGATCTC ATAGAACCCA GCTTTCTTGT 1021 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1081 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1141 GAAAGGACGA GAACACGTGA AATTCCCTAC ACAAACGCGT TAAGTCgaca atcaacctct 1201 ggattacaaa atttgtgaaa gatt