Construct: ORF TRCN0000487923
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020316.1_s317c1
- DNA Barcode:
- GATATGCTGATTTGGGTTGCTATC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NEK7 (140609)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487923
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 140609 | NEK7 | NIMA related kinase 7 | NM_133494.3 | 100% | 100% | |
| 2 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_017000344.1 | 97.4% | 97.4% | 370_393del |
| 3 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_017000345.1 | 97.4% | 97.4% | 370_393del |
| 4 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_017000346.1 | 85.1% | 85.1% | 370_393del;708_709ins114 |
| 5 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_017000347.1 | 67.7% | 63.8% | (many diffs) |
| 6 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_017000348.1 | 67.7% | 63.8% | (many diffs) |
| 7 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_011509209.1 | 52.9% | 52.9% | 372_373ins426 |
| 8 | mouse | 59125 | Nek7 | NIMA (never in mitosis gene... | NM_021605.4 | 91.2% | 97.6% | (many diffs) |
| 9 | mouse | 59125 | Nek7 | NIMA (never in mitosis gene... | NM_001311148.1 | 60.6% | 64.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 978
- ORF length:
- 906
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggatgag caatcacaag gaatgcaagg gccacctgtt cctcagttcc 121 aaccacagaa ggccttacga ccggatatgg gctataatac attagccaac tttcgaatag 181 aaaagaaaat tggtcgcgga caatttagtg aagtttatag agcagcctgt ctcttggatg 241 gagtaccagt agctttaaaa aaagtgcaga tatttgattt aatggatgcc aaagcacgtg 301 ctgattgcat caaagaaata gatcttctta agcaactcaa ccatccaaat gtaataaaat 361 attatgcatc attcattgaa gataatgaac taaacatagt tttggaacta gcagatgctg 421 gcgacctatc cagaatgatc aagcatttta agaagcaaaa gaggctaatt cctgaaagaa 481 ctgtttggaa gtattttgtt cagctttgca gtgcattgga acacatgcat tctcgaagag 541 tcatgcatag agatataaaa ccagctaatg tgttcattac agccactggg gtggtaaaac 601 ttggagatct tgggcttggc cggtttttca gctcaaaaac cacagctgca cattctttag 661 ttggtacgcc ttattacatg tctccagaga gaatacatga aaatggatac aacttcaaat 721 ctgacatctg gtctcttGGC TGTCTACTAT ATGAGATGGC TGCATTACAA AGTCCTTTCT 781 ATGGTGACAA AATGAATTTA TACTCACTGT GTAAGAAGAT AGAACAGTGT GACTACCCAC 841 CTCTTCCTTC AGATCACTAT TCAGAAGAAC TCCGACAGTT AGTTAATATG TGCATCAACC 901 CAGATCCAGA GAAGCGACCA GACGTCACCT ATGTTTATGA CGTAGCAAAG AGGATGCATG 961 CATGCACTGC AAGCAGCTGA GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1021 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1081 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGATA TGCTGATTTG 1141 GGTTGCTATC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt