Transcript: Mouse NM_001311148.1

Mus musculus NIMA (never in mitosis gene a)-related expressed kinase 7 (Nek7), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nek7 (59125)
Length:
4112
CDS:
233..838

Additional Resources:

NCBI RefSeq record:
NM_001311148.1
NBCI Gene record:
Nek7 (59125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145539 ACCTAAAGAATGTGCAGCTG pXPR_003 TGG 574 95% 7 -0.5206 Nek7 NEK7 77739
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222274 CGGCCAGATATGGGCTATAAT pLKO.1 299 CDS 100% 15.000 21.000 N Nek7 n/a
2 TRCN0000236004 ACCCGACATCGCCTATGTTTA pLKO_005 869 3UTR 100% 13.200 18.480 N Nek7 n/a
3 TRCN0000236006 ACGGCCAGATATGGGCTATAA pLKO_005 298 CDS 100% 13.200 18.480 N Nek7 n/a
4 TRCN0000236005 TGGAGTGCCGGTAGCGTTAAA pLKO_005 400 CDS 100% 13.200 18.480 N Nek7 n/a
5 TRCN0000236008 CACTGTAATGCAAGCATATAT pLKO_005 1770 3UTR 100% 15.000 10.500 N Nek7 n/a
6 TRCN0000222276 GCATCATTCATTGAGGATAAT pLKO.1 527 CDS 100% 13.200 9.240 N Nek7 n/a
7 TRCN0000199184 CCACAGCTGCACATTCTTTAG pLKO.1 801 CDS 100% 10.800 7.560 N NEK7 n/a
8 TRCN0000222278 CGAAGAGTCATGCACAGAGAT pLKO.1 695 CDS 100% 4.950 3.465 N Nek7 n/a
9 TRCN0000222277 CGTGGACAATTTAGTGAAGTT pLKO.1 356 CDS 100% 4.950 3.465 N Nek7 n/a
10 TRCN0000194795 CCAGCTAATGTGTTCATTACA pLKO.1 722 CDS 100% 0.563 0.394 N NEK7 n/a
11 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2876 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487923 GATATGCTGATTTGGGTTGCTATC pLX_317 27.1% 60.6% 64.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000470840 GATCCCGGCAACAACTACTCGAAC pLX_317 36% 60.2% 22.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_15254 pDONR223 100% 60.2% 22.3% None (many diffs) n/a
4 ccsbBroad304_15254 pLX_304 0% 60.2% 22.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV