Transcript: Human XM_017000344.1

PREDICTED: Homo sapiens NIMA related kinase 7 (NEK7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEK7 (140609)
Length:
4136
CDS:
306..1238

Additional Resources:

NCBI RefSeq record:
XM_017000344.1
NBCI Gene record:
NEK7 (140609)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199087 CGACCGGATATGGGCTATAAT pLKO.1 372 CDS 100% 15.000 21.000 N NEK7 n/a
2 TRCN0000001967 CTTTAGTTGGTACGCCTTATT pLKO.1 913 CDS 100% 13.200 18.480 N NEK7 n/a
3 TRCN0000199150 CACGTGCTGATTGCATCAAAG pLKO.1 529 CDS 100% 10.800 15.120 N NEK7 n/a
4 TRCN0000001966 GCGGACAATTTAGTGAAGTTT pLKO.1 430 CDS 100% 5.625 7.875 N NEK7 n/a
5 TRCN0000194884 CCTATGTTTATGACGTAGCAA pLKO.1 1186 CDS 100% 3.000 4.200 N NEK7 n/a
6 TRCN0000196722 GAGTCATGCATAGAGATATAA pLKO.1 796 CDS 100% 15.000 10.500 N NEK7 n/a
7 TRCN0000001969 GAAGAGTGTAACCAAAGTAAT pLKO.1 1253 3UTR 100% 13.200 9.240 N NEK7 n/a
8 TRCN0000199184 CCACAGCTGCACATTCTTTAG pLKO.1 898 CDS 100% 10.800 7.560 N NEK7 n/a
9 TRCN0000194964 CTATATGAGATGGCTGCATTA pLKO.1 1005 CDS 100% 10.800 7.560 N NEK7 n/a
10 TRCN0000001968 TCAGATCACTATTCAGAAGAA pLKO.1 1107 CDS 100% 4.950 3.465 N NEK7 n/a
11 TRCN0000010671 TGGCTGCATTACAAAGTCCTT pLKO.1 1015 CDS 100% 2.640 1.848 N NEK7 n/a
12 TRCN0000194795 CCAGCTAATGTGTTCATTACA pLKO.1 819 CDS 100% 0.563 0.394 N NEK7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487923 GATATGCTGATTTGGGTTGCTATC pLX_317 27.1% 97.4% 97.4% V5 (not translated due to prior stop codon) 370_393del n/a
2 TRCN0000470840 GATCCCGGCAACAACTACTCGAAC pLX_317 36% 96.9% 14.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_15254 pDONR223 100% 96.4% 14.8% None (many diffs) n/a
4 ccsbBroad304_15254 pLX_304 0% 96.4% 14.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV